Amphibians Research Articles

New amphibians with no limbs

New amphibians with no limbs

Altitudinal variation in body size in the Rice Frog ( Rana limnocharis ) in southwestern China

Bergmann’s rule states that, within species of endotherms, individuals tend to be larger in cooler environments, and has been reputed to apply to some ectotherms including amphibians. However, the validity of the rule has been debated, questioning whether Bergmann’s clines are generally present in anurans. In the view, we studied altitudinal variation in body size in the rice frog ( Rana limnocharis ) among populations from Sichuan province located at three altitudes to find if there exist any differences in a relatively small altitudinal range (290-375 m). The results showed that individuals from higher altitudes tended to be larger in body size than lower altitudes, which was consistent with Bergmann’s cline. Moreover, when the effect of age was removed, variation in body size of the frogs across altitudes still remained. Our findings suggested that age affected the pattern of variation in body size across the altitudinal cline, we also discussed that factors other than age also contributed to size differences among populations.

中国井冈山生态系统多样性

Jinggangshan(N26°13′—26°52′,E113°59′—114°18′) is in the middle of the east slope of Luoxiao Mountain and the overall topography is higher in southwest and gradually lower towards north and east.It lies in the middle subtropical zone and has obvious seasons.There are abundant precipitation and heat resource.The annual temperature is 14.2℃ and the annual rainfall is 1889.8 mm.The highest site is in the south face,2120.4 m,while the lowest site is in Qixiling Longtan port with an altitude of 200 m,the greatest difference in altitude is up to 1920 m.The Jinggangshan Mountain is magnificent and steep with lots of cliffs.There are beaded basins(depressions) with dendritic water system among the hills.There are riffles and rapids in some regions,forming water falls in narrow gorge.Jingganshan has complex geography,which is the base of diverse community and ecosystem.In general,the diverse types of ecosystem have the potential to support diverse biological communities.However,it is rare to study the ecosystem types in Jinggangshan area.And it is unclear how complex the ecosystems on different scales.Therefore,ecosystem types in Jinggangshan were studied,and the relationship between ecosystem and species biodiversity was discussed.This will be the basis of ecological protection and environmental management in Jinggangshan area.Based on the First-level IUCN/SSC Habitat classification,there are 9 First-level habitats(almost including all the habitats except marine habitat) in Jingganshan area,suggesting the habitat is plentiful.Forest is the largest area among these first-level habitats,which is the key foundation of the diversity of natural ecosystem and vegetation types.Then the sub-habitats(such as shrubs,grassland and water) enrich the complexity and integrity of ecosystem.The first-level habitats in Jinggangshan,being related to the diversity of ecosystem type,are the basic of ecosystem classification.In addition,here we used an integrative classification of ecosystem based on the origin of ecosystem,the geography of ecosystem,the habitat or attribute of ecosystem,as well as the structure and function of ecosystem.The results showed that there are 53 types of ecosystem in Jinggangshan,twenty-one of which is natural ecosystems(including forest,grassland and still water ecosystem etc.),14 is artificial ecosystem(including artificial wetland,artificial forest,agricultural ecosystems ect.),and 18 is complex ecosystems(including semi-natural ecosystems and semi-artificial ecosystems etc.).This classification only reaches 4 levels.In fact there are still plentiful ecosystem types below the 4th level.For instance,the 4th level ecosystem Broad-leaved forest can be divided into ravine evergreen forest,typical evergreen forest,deciduous broad-leaved forest,mountaintop evergreen broad-leaved copse ecosystem etc.And the 4th level ecosystem lentic ecosystem(lake,reservoir,water pool) can be divided into lake,reservoir and water pool ecosystem.This indicates that there are plentiful ecosystem types in Jinggangshan area.Vegetation covered the largest proportion in Jinggangshan area.Thus the plant community was investigated in order to understand the diversity of ecosystem in Jinggangshan.The results showed that there were 14 vegetations,90 formations and 180 associations.Comparing with adjacent heritages,there are the most vegetation types in Jinggangshan.The vegetation types are nearly 3 times of the adjacent Sanqingshan Heritage and Wuyishan Heritage though the area of Jinggangshan is smaller than those two heritages.Within a certain range,the biodiversity depends on the diversity of habitat and the key construct elements.There are the highest higher plant species and amphibians in Jinggangshan relative to those 7 adjacent heritage sites,while insect species is only second to Wuyi Mountain,and the bird species is only second to Danxia Mountain.The complex and diverse topography and landform in Jinggangshan form various habitats and ecosystems,provides plentiful niches,which is undoubtedly the foundation of the coexisting animals and plants.Although there are limited space(distribution area) in Jinggangshan,the plentiful differentiated niches makes it possible to breed and grow much more species in Jinggangshan.We concluded that the plentiful habitats and various types of ecosystems are the main basic of high diversity of biological community,which is the foundation of high diversity of biological species in Jinggangshan area.

Florida's frogs, toads, and other amphibians: a guide to their identification and habits

Florida's frogs, toads, and other amphibians: a guide to their identification and habits

Cerebral and Behavioural Asymmetries in Animal Social Recognition

Evidence is here summarized that animal species belonging to distant taxa show forms of social recognition, a sophisticated cognitive ability adaptive in most social interactions. The paper then proceeds to review evidence of functional lateralization for this cognitive ability. The main focus of this review is evidence obtained in domestic chickens, the animal model employed in the authors’ laboratories, but we also discuss comparisons with data from species ranging from fishes, amphib ians and reptiles, to other birds and mammals. A consistent pattern emerges, pointing toward a right hemisphere dominance, in particular for discrimination of social companions and individual (or familiarity-based) recognition, whereas the left hemisphere could be specialized for “category-based” distinctions (e.g., conspecifics versus heterospecifics). This pattern of results is discussed in relation to a more general specialization and processing styles of the two sides of the brain, with the right hemisphere predisposed for developing a detailed, global and contextual representation of objects, and the left hemisphere predisposed for rapid assignment of a stimulus to a category, for processing releaser stimuli and for control of responses.

New Data on Amphibians and Reptiles Distribution in the Russian Far East

The data on new findings of amphibians and reptiles in the Khabarovsk Territory, Amurskaya Region, and Evreiskaya Autonomous Region, obtained from 1990 to 1998 are reported. The information about records of Bufo gargarizans (Anura, Bufonidae) and Hyla japonica (Anura, Hylidae) on the limit of their distribution is included. The findings of Amphiesma vibakari and Elaphe rufodorsata (both Serpentes, Colubridae) are the first records of those reptiles in the Evreiskaya Autonomous Region and new for Middle Amur area. As for E. rufodorsata it is an extreme north-west location of the species in the Russian Far East. All the data of 248 locations are mapped.

Conservation-Oriented Herpetological Research in Israel

Israel is small and shared by contrasting ecological regions. Local amphibian and many reptilian populations are at peril as components of endangered ecosystems, and because they live at the limit of specific ranges and requirements. Some of them are also endangered commercially. Most local herpetological research efforts have been conservation-oriented on three levels: (1) Studies of endangered species: ecology in the field, specific requirements (incubation etc.) and taxonomic definition of taxa for protection. (2) Studies of other species, contributing data to conservation policy. (3) A policy to prefer investigations not requiring the collection of specimens.

Reptile and amphibian conservation through gene banking and other reproduction technologies

More than 300 of the ~6180 known reptile species are critically endangered or endangered, with more than 200 known amphibian species extinct, and ~1230 of the ~6800 known amphibian species are critically endangered or endangered. To assure the survival of these species conservation breeding programs (CBPs) are being established. The perpetuation of genetic variation is required in both CBPs and in natural populations, to maintain health and reproduction, and to enable adaptation to environmental change. However, over time genetic variation is often lost in CBPs and in small or fragmented natural populations. Reproduction technologies including gene banking through the use of sperm cryopreservation can perpetuate genetic variation. These technologies are being applied to amphibian conservation, however, their development and use for reptiles has received only sporadic attention. We review the use of reproduction technologies for the conservation of amphibians and reptiles including the hormonal induction of sperm and oocytes, their use in artificial fertilisation, and the potentials of sperm cryopreservation for gene banking. Support for the use of reproduction technologies, and the perpetuation of genetic variation of threatened amphibians and reptiles, will benefit from practical examples of the recovery of genetic variation from stored sperm, and its use to provide competent individuals for rehabitation programs and to supplement populations.

Progress in retinal stem cells research

Retina is subjected to many acquired and inherited neuronal degenerative diseases such as agerelated macular degeneration (AMD), diabetic retinopathy (DR) and retinitis pigmentosa (RP). All of these diseases are associated with the progressive damage and loss of photoreceptors, which is causing visual impairment and irreversible blindness. Stem-cell therapy is being widely considered as a promising treatment of these incurable retina diseases. However, in mammals including humans, there seems to be little or no recovery of lost cells. By contrast, nonmammalian vertebrates, such as amphibians and fish, have robust regenerative responses to injury, which can lead to the near complete restoration of the neurons lost through injury. Nevertheless ,over the past several years, studies have investigated that stem cells do exist in the adult mammalian eyes, and at least some types of neurons can be regenerated in the mammalian retina by stimulating with growth factors or transcription factors. These recent results suggest that some part of the regenerative program occurring in lower vertebrates remains in the mammalian retina.Here, the origin of various of adult retinal stem cells for the self-renewal and proliferation. and the relevant influencing factors were summarized. Key words: Retina; Stem cells ; Muller cells; Mesenchymal stem cells; Induced pluripotent stem cells

Expression of MIS Receptors in the Oocyte of Indian Major Carp, Cirrhinus mrigala

Introduction: Many actions of steroids are too rapid to be readily explained be the classical genomic mechanism of steroid action mediated by activation of nuclear steroid receptors. The receptors mediating these rapid steroid actions have been studied extensively in many laboratories over the past 30 years. The binding moieties with the characteristics of progestin membrane receptors have been demonstrated in fish and amphibian oocytes and some other vertebrate tissues. Maturation-inducing steroid (MIS) receptors are potential intermediaries in meiotic maturation of oocytes. 17α,20β-dihydroxy-4pregnen-3-one (17α,20β-DHP) has been identified as the MIS in many teleosts, and induces oocytes to enter into final meiotic maturation leading to ovulation. The MIS receptors are membrane progestin receptors (mPR) and are responsible to mediate rapid non-genomic progestin action. The mPRs are mainly consisting of three forms such as mPRα, mPRβ and mPRγ. An attempt has been made to identify the receptors encoding gene in an Indian major carp, Cirrhinus mrigala. Methods: The immature and mature oocytes of C. mrigala were collected during the month of May (vitellogenic stage) and August (gravid stage) in RNA later, and total RNA was extracted using guanidine thiocyanate method. The extracted RNA was reverse transcribed to cDNA by MMuLV, RT-PCR kit (Medox). Specific primers (Sigma, USA) were constructed for mPRα, mPRβ and mPRγ and applied to catch the specific gene. The primers are mPRα sense ‘CTGTCCTGTACGGGCTG’, and antisense ‘CTCCTGCTTGTCTTCTAGATACGC’, mPRβ sense ‘ACTGGTTTCCCCGTCTACCT’, and antisense ‘GTACAGGACAGCCAGGCCAGGA’, mPRγ  sense ‘AACTCCTCGGATCCCAAAC’, and antisense ‘TGTGATAGCACAGCCGAGAC’. The PCR products were visualized by gel electrophoresis using ethidium bromide. The PCR amplified product was quantified and sequenced (Genei, India). Results and Discussion: The mPRα does not show any difference between the vitellogenic and gravid stage of oocytes (lane 1 and 2) and the mPRβ has the band intensity difference between the two stages (lane 3 and 4) whereas mPRγ could not be identified in the gravid stage (lane 6) in reference with the 100bp DNA marker (lane 7). The results confirm the possible expression of membrane progestin receptors mPRα and mPRβ in the matured oocytes and mPRγ gene expression in the mid vitellogenic stage of C. mrigala. This is the first demonstration of MIS receptor gene expression in the oocytes of C. mrigala. In previous studies Yukinori et al. [1] reported that in channel catfish mPRα transcripts gradually increased during oocyte growth, mPRβ varied slightly throughout the reproductive cycle whereas in zebrafish mPRβ level increased during the follicular development stage. In sea trout, Zhu et al. [2] reported that mPRα was expressed in the plasma membrane, mPRβ brain and oocyte, and mPRγ was expressed in the oocyte as well as kidney. The present result also suggests that the mPRγ is not playing any role in the final maturation, however mPRα and mPRβ transcription is seasonally varied with maturity of oocytes. The partially sequenced genes (mPRα-979bp, mPRβ-981bp and mPRγ-521bp) were used to construct phylograms which indicate that C. mrigala is closely related to Carassius auratus and Danio rerio in comparison with other teleosts.

AN ANNOTATED CATALOGUE OF THE AMPHIBIAN TYPES IN THE COLLECTION OF THE ZOOLOGICAL INSTITUTE, RUSSIAN ACADEMY OF SCIENCES, ST. PETERSBURG

A complete catalogue is provided of the type specimens of amphibians in the herpetological collection of the Zoological Institute, Russian Academy of Sciences, St. Petersburg. The collection contains 513 type specimens representing 103 taxa in 18 families under consideration. Of these 69 taxa are currently recognized as valid species or subspecies.

LATE PLEISTOCENE RODENTS (MAMMALIA: RODENTIA) FROM THE BARANICA CAVE NEAR KNJAZEVAC (EASTERN SERBIA): SYSTEMATICS AND PALAEOECOLOGY

Baranica is a cave in the Balkan mountain range in the eastern part of Serbia. It contains four layers of sediments of Quaternary age. The Upper Pleistocene deposits (layers 2-4) have yielded a rich and diverse assemblage of vertebrate fauna, including fish, amphibians, reptiles, birds, and small and large mammals. In this work, preliminary results of a study of the rodent fauna from the Upper Pleistocene deposits of the Baranica Cave (Knjazevac, eastern Serbia) are presented. The fossil material comes from the 1995 archaeological excavation. The remains of 10 rodent species are described herein: Spermophilus cf. citelloides, Castor fiber , Sicista subtilis , Cricetulus migratorius , Cricetus cricetus , Mesocricetus newtoni , Apodemus ex gr. sylvaticus-flavicollis, Spalax leucodon, Dryomys nitedula, and Muscardinus avellanarius. Along with eight vole species, this makes altogether 18 species of rodents found in this locality. Both layers 2 and 4 (layer 3 is very poor in fossils) have yielded a rodent fauna typical for the cold periods of the Late Pleistocene on the Balkan Peninsula, with a prevalence of open and steppe inhabitants, but some forest dwellers were also present. The assemblages from these layers are similar, but there are some differences in the composition of the fauna, which may indicate a slight shift towards drier conditions. They have also been compared to rodent associations from some Serbian and Bulgarian localities of the same age and their similarities and differences are discussed. SHORT NOTE-NOTA BREVE

The Balearic herpetofauna: a species update and a review on the evidence

th May. Abstract. Here, we update the current list of amphibian and reptile fauna present in the Balearic Islands, probably the most outstanding case in the Mediterranean and of the most in the world where massive species introduction is in conflict with the survi- vorship of highly restricted endemic taxa. Resulting of a long term evolution in insu- larity, endemic herpetofauna was already decimated during the Pleistocene but, after the human colonisation of the archipelago, the introduction of alien species, passive or deliberate, has been provoking new extinctions and range retractions in the native her - petofauna. Such process is not interrupted but has even intensified during the last years. The current species list is composed by five amphibians (one native) and 21 reptiles (2 native). A critical review of the evidence on extinctions and introductions is provided together with the conservation implications. Compared to the last review (Mayol, 1985) six new reptile species are now naturalised or are in process of naturalization, colubrid snakes constituting the most conflicting element due to their predator role.

The Association of Reptilian and Amphibian Veterinarians

The Association of Reptilian and Amphibian Veterinarians

Assessment of Characteristics and Functions of Abandoned Rice Paddy Wetlands as Habitats for the Amphibia within Land Development Districts

The current study analyzed appropriateness of abandoned rice paddy wetlands as habitats for the Amphibia by assessing functions and value of abandoned rice paddy wetlands within land development districts as a habitat for living creatures and researching into the Amphibia living in the subject districts. For this purpose, the study designated abandoned rice paddy wetlands within Hwaseong A District and Pangyo B District under land development as subject lands. Those wetlands went through succession after abandonment of farming. Detailed study results are as follows. From classification of wetland types and an analysis of their characteristics, it was found that herbaceous plants such as smartweed communities, horsetail communities and reed communities, and woody plants such as pussy willow communities appeared in both districts. These abandoned rice paddy wetlands shows typical characteristics of palustrine wetlands. As a result of a vegetation structure research, it was observed that succession has been progressed for at least over 2~3 years. In assessment of wetland functions by item, it was found that they are developing into fine wetlands in terms of functions because they are ranked over Moderate Class except separate distance from streams. Also from a research into animals living in the abandoned rice paddy wetlands, it was found that main inhabitants are Rana nigromaculata,Rana dybowskii, Hyla japonica, Bufo bufo gargarizans, etc. It can be confirmed that the abandoned rice paddy wetlands are providing appropriate conditions as habitats to the Amphibia in a view that those species have life cycles of inhabitation (shores and wetlands) - egg-laying (rice paddy, puddles and swampy places) - hibernation (rice field banks and swampy places). From this point of view, it was found that abandoned rice paddy wetlands that developed because of abandonment of farming can be used as means to improve structure and functions of habitats.

Amphibians of the “Cilento e Vallo di Diano” National Park (Campania, Southern Italy): updated check list, distribution and conservation notes

In this study, we present the results of our field and bibliographic survey on the amphibians of the “Cilento and Vallo di Diano” National Park (Southern Italy). Two hundred and thirty three spawning sites (167 original and 66 derived from literature), and 11 amphibian species were found. Reproductive activity was recorded for Salamandra salamandra , Salamandrina terdigitata , Triturus carnifex , Lissotriton italicus , Bufo bufo , Hyla intermedia , Rana italica , Rana dalmatina and Pelophylax synkl. hispanica . The distribution record of many species is widely improved with respect to bibliographic data. Our results also suggested that preservation and restoration of small aquatic sites, in particular of the artificial ones, such as stony wells and drinking-troughs, are fundamental for an appropriate conservation management of amphibians in the “Cilento and Vallo di Diano” National Park.

The Gargano Terre Rosse insular Faunas: an Overview

After forty years from its discovery, the history of the field surveys and of the researches on the fossiliferous deposits on Gargano is briefly reported. The Gargano fauna belongs to the Abruzzo-Apulian Palaeobioprovince (including also Scontrone and Palena, Abruzzo). The fossil assemblage comprehends all the classes of terrestrial vertebrates: Reptilia, Amphibia, Aves and Mammalia. The faunal composition is unbalanced and presents the features of a typical insular endemic fauna. The bulk of the assemblage is composed of small mammals and birds. Based on literature, we report the most characteristic features, phylogenetic relationships, and evolutionary remarks on a list of mammals, focusing particularly on the adaptations of the most endemic taxa. Moreover, a biochronological scheme of the major faunal events is proposed and illustrated. Although still imperfect, the scheme is the first synopsis of all the biochronological and taxonomical information on mammals so far available. Eventually, the hypotheses on the origin and modes of colonisation are summarized and shortly discussed. From this overview the Gargano fauna is indeed of great interest for studies of evolution and biogeography. Nonetheless, there are persistent uncertainties on its age and origin, as well as on the age of infilling of the karstic fissure system of this unique fossiliferous locality.

Amphibians & reptiles of the Carolinas and Virginia

Amphibians & reptiles of the Carolinas and Virginia

Amphibians wiped out before they are discovered

Amphibians wiped out before they are discovered

A skeletochronological estimation of age structure in a population of the Guenther's frog, Hylarana guentheri, from western China

Age determination in amphibians is crucial to investigation of life-history traits. In this context, we studied age structure of the Guenther's frog, Hylarana guen- theri, population from southwestern China located at an altitude of 300 m using skel- etochronological method. Our results showed that age in adult males ranged from 1 to 4 years, and from 2 to 6 years in adult females. Average age in females was significant- ly older than males in 2008 and 2009. Also, females had significantly larger average body size than males in both years. A significant relationship between age and body size within each sex was found in this species for both years. The ANCOVA analy - sis revealed that there was significant difference in body size between sexes when the effect of age was removed. The von Bertalanffy's model showed that females had larger asymptotic body size than males, but growth rate of females was smaller than males.