Amino Acid Distances Research Articles

Protein-ligand binding residue prediction enhancement through hybrid deep heterogeneous learning of sequence and structure data.

Knowledge of protein-ligand binding residues is important for understanding the functions of proteins and their interaction mechanisms. From experimentally solved protein structures, how to accurately identify its potential binding sites of a specific ligand on the protein is still a challenging problem. Compared with structure-alignment-based methods, machine learning algorithms provide an alternative flexible solution which is less dependent on annotated homogeneous protein structures. Several factors are important for an efficient protein-ligand prediction model, e.g. discriminative feature representation and effective learning architecture to deal with both the large-scale and severely imbalanced data. In this study, we propose a novel deep-learning-based method called DELIA for protein-ligand binding residue prediction. In DELIA, a hybrid deep neural network is designed to integrate 1D sequence-based features with 2D structure-based amino acid distance matrices. To overcome the problem of severe data imbalance between the binding and nonbinding residues, strategies of oversampling in mini-batch, random undersampling and stacking ensemble are designed to enhance the model. Experimental results on five benchmark datasets demonstrate the effectiveness of proposed DELIA pipeline. The web server of DELIA is available at www.csbio.sjtu.edu.cn/bioinf/delia/. Supplementary data are available at Bioinformatics online.

Identification of animal hosts of Fort Sherman virus, a New World zoonotic orthobunyavirus.

An orthobunyavirus termed Fort Sherman virus (FSV) was isolated in 1985 from a febrile US soldier in Panama, yet potential animal reservoirs remained unknown. We investigated sera from 192 clinically healthy peri-domestic animals sampled in northeastern Brazil during 2014-2018 by broadly reactive RT-PCR for orthobunyavirus RNA, including 50 cattle, 57 sheep, 35 goats and 50 horses. One horse sampled in 2018 was positive (0.5%; 95% CI, 0.01-3.2) at 6.2×103 viral RNA copies/mL. Genomic comparisons following virus isolation in Vero cells and deep sequencing revealed high identity of translated amino acid sequences between the new orthobunyavirus and the Panamanian FSV prototype (genes: L, 98.8%; M, 83.5%; S, 100%), suggesting these viruses are conspecific. Database comparisons revealed even higher genomic identity between the Brazilian FSV and taxonomically unassigned Argentinian mosquito- and horse-derived viruses sampled in 1965, 1982 and 2013 with only 1.1% maximum translated amino acid distancesacross viral genes, suggesting the Argentinian viruses were also distinct FSV strains. The Panamanian FSV strain was an M gene reassortant relative to all Southern American FSV strains, clustering phylogenetically with Cache Valley virus (CVV). Mean dN/dS ratios among FSV genes ranged from 0.03 to 0.07, compatible with strong purifying selection. FSV-specific neutralizing antibodies occurred at relatively high end-point titres in the range of 1:300 in 22.0% of horses (11 out of 50 animals), 8.0% of cattle (4/50 animals), 7.0% of sheep (4/57 animals) and 2.9% of goats (1/35 animals). High specificity of serologic testing was suggested by significantly higher overall FSV-specific compared to CVV- and Bunyamwera virus-specific end-point titres (p=.009), corroborating a broad vertebrate host range within peri-domestic animals. Growth kinetics using mosquito-, midge- and sandfly-derived cell lines suggested Aedes mosquitos as potential vectors. Our findings highlight the occurrence of FSV across a geographic range exceeding 7,000km, surprising genomic conservation across a time span exceeding 50years, M gene-based reassortment events, and the existence of multiple animal hosts of FSV.

DistAA: Database of amino acid distances in proteins and web application for statistical review of distances

Three-dimensional structure of a protein chain is determined by its amino acid interactions. One approach to the analysis of amino acid interactions refers to geometric distances of amino acid pairs in polypeptide chains. For a detailed analysis of the amino acid distances, the database with three types of amino acid distances in a set of chains was created. Web application Distances of Amino Acids has also been developed to enable scientists to explore interactions of amino acids with different properties based on distances stored in the database. Web application calculates and displays descriptive statistics and graphs of amino acid pair distances with selected properties, such as geometric distance threshold, corresponding SCOP class of proteins and secondary structure types. In addition to the analysis of pre-calculated distances stored in the database, the amino acid distances of a single protein with the specified PDB identifier can also be analyzed. The web application is available at http://andromeda.matf.bg.ac.rs/aadis_dynamic/.

Polymorphism of gene Hemagglutinin and its influence on the properties of influenza virus a H1N1 and H7N9 strains

Influenza virus A is a causative agent of zoonotic and anthroponosis diseases. Virulence and contagious properties of the influenza virus are dependent on the presence of hemagglutinin. The membrane glycoprotein hemagglutinin has an important part in the adhesion and invasion of the influenza virus to the cell, as well as in the formation of immunity of the host organism. Hemagglutinin forms pandemic properties of influenza strains. Systematics and characterization of the influenza virus strains are based in particular on the type of hemagglutinin. The most contagious strains of the influenza A virus are strains H1N1 and H7N9. Polymorphism of hemagglutinin and its effect on the properties of influenza strains makes it relevant to study its variability.The aim of the study. The purpose of the study was to determine the polymorphism of the hemagglutinin encoding gene of strains of the influenza A H1N1 and H7N9 strains, to determine its effect on the polymorphism of the amino acid sequences of hemagglutinin and the properties of the strains by bioinformatic research methods.Materials and methods. The nucleotide sequences of hemagglutinin of influenza A H1N1 and H7N9 strains and products of its translation were analyzed by cluster analysis. The properties of hemagglutinin were defined by determining its domains.Results and discussion. As a result of the study, the polymorphism and genetic distances between the alleles of the gene encoding hemagglutinin of the influenza virus have been calculated and its translation has been carried out. The polymorphism and amino acid distances between the products of its translation were detected; a comparative analysis between the nucleotide and amino acid sequences was performed. The influence and effect of synonymouscodons in the nucleotide sequences of the alleles of the hemagglutinin encoding gene on the hemagglutinin polymorphism was shown. The domains of the test samples of hemagglutinin were identified.Conclusions. As a result of studies, the absence of the influence of the polymorphism of the hemagglutinin encoding gene on the hemagglutinin polymorphism was shown. The absence of the effect of polymorphism on the amino acid sequences of hemagglutinin of influenza A H1N1 and H7N9 strains, as well as on the domain composition and, thus, on the properties of strains was determined

Prediction of Enzyme Function Based on Three Parallel Deep CNN and Amino Acid Mutation.

During the past decade, due to the number of proteins in PDB database being increased gradually, traditional methods cannot better understand the function of newly discovered enzymes in chemical reactions. Computational models and protein feature representation for predicting enzymatic function are more important. Most of existing methods for predicting enzymatic function have used protein geometric structure or protein sequence alone. In this paper, the functions of enzymes are predicted from many-sided biological information including sequence information and structure information. Firstly, we extract the mutation information from amino acids sequence by the position scoring matrix and express structure information with amino acids distance and angle. Then, we use histogram to show the extracted sequence and structural features respectively. Meanwhile, we establish a network model of three parallel Deep Convolutional Neural Networks (DCNN) to learn three features of enzyme for function prediction simultaneously, and the outputs are fused through two different architectures. Finally, The proposed model was investigated on a large dataset of 43,843 enzymes from the PDB and achieved 92.34% correct classification when sequence information is considered, demonstrating an improvement compared with the previous result.

MHC class I diversity predicts non-random mating in Chinese alligators (Alligator sinensis)

The major histocompatibility complex (MHC) has several important roles in kin recognition, pathogen resistance and mate selection. Research in fish, birds and mammals has suggested that individuals optimise MHC diversity, and therefore offspring fitness, when choosing mates. In reptiles, however, it is unclear whether female mate choice is based on genome-wide genetic characteristics such as microsatellite DNA loci, particular functional-trait loci (e.g., MHC) or both, and MHC's effects on mate choice remain relatively understudied. Herein, we used 13 microsatellite loci and two MHC class I loci to investigate female mate choice of Chinese alligators (Alligator sinensis) in the semi-natural condition. We also determined correlations between the MHC genotype of breeding males and male reproductive success. We found that MHC-heterozygous males harbour a greater reproductive success, which probably is the reason that these males are more preferred by the females than MHC-homozygous males. Furthermore, the MHC class I amino-acid distance and functional distance of true mating pairs were higher compared with those of randomly sampled pairs. Analysis of microsatellites revealed that, despite mate choice, females did not completely avoid inbreeding. These findings are the first evidence of MHC-associated mate choice in Chinese alligators, suggesting that females may adopt different mating strategies after assessing the MHC characteristics of potential mates.

Viral genetic diversity and protective efficacy of a tetravalent dengue vaccine in two phase 3 trials

Two phase 3 placebo-controlled trials of the CYD-TDV vaccine, evaluated in children aged 2-14 y (CYD14) and 9-16 y (CYD15), demonstrated vaccine efficacy (VE) of 56.5% and 60.8%, respectively, against symptomatic virologically confirmed dengue (VCD). Sieve analyses were conducted to evaluate whether and how VE varied with amino acid sequence features of dengue viruses (DENVs). DENV premembrane/envelope amino acid sequences from VCD endpoint cases were aligned with the vaccine insert sequences, and extensions of the proportional hazards model were applied to assess variation in VE with amino acid mismatch proportion distances from vaccine strains, individual amino acid residues, and phylogenetic genotypes. In CYD14, VE against VCD of any serotype (DENV-Any) decreased significantly with increasing amino acid distance from the vaccine, whereas in CYD15, VE against DENV-Any was distance-invariant. Restricting to the common age range and amino acid distance range between the trials and accounting for differential VE by serotype, however, showed no evidence of VE variation with distance in either trial. In serotype-specific analyses, VE against DENV4 decreased significantly with increasing amino acid distance from the DENV4 vaccine insert and was significantly greater against residue-matched DENV4 at eight signature positions. These effects were restricted to 2- to 8-y-olds, potentially because greater seropositivity of older children at baseline might facilitate a broader protective immune response. The relevance of an antigenic match between vaccine strains and circulating DENVs was also supported by greater estimated VE against serotypes and genotypes for which the circulating DENVs had shorter amino acid sequence distances from the vaccine.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms.

Background and Aim:Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and Methods:The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.Result:The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.Conclusion:Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Evolutionary dynamics of GII.17 norovirus.

BackgroundDuring the winter of 2014–2015, a rarely reported norovirus (NoV) genotype GII.17 was found to have increased its frequency in norovirus outbreaks in East Asia, surpassing the GII.4 NoV infections. GII.17 genotype has been detected for over three decades in the world. The aim of this study is to examine the evolutionary dynamics of GII.17 over the last four decades.MethodsNoV GII.17 sequences with complete or nearly complete VP1 were downloaded from GenBank and the phylogenetic analyses were then conducted.ResultsThe maximum likelihood analysis showed that GII.17 genotype could be divided into four different clades (Clades A–D). The strains detected after 2012, which could be the cause of the outbreaks, were separated into Clades C–D with their mean amino acid distance being 4.5%. Bayesian Markov chain Monte Carlo analyses indicated that the rate of nucleotide substitution per sites was 1.68 × 10−3 nucleotide substitutions/site/year and the time of the most recent common ancestor was 1840. The P2 subdomain of GII.17 was highly variable with 44% (56/128) amino acids variations including two insertions at positions 295–296 and one deletion at position 385 (Clades C and D) and one insertion at position 375 (Clade D). Variations existed in Epitopes A, B and D corresponding to GII.4 and human histo-blood group antigens binding site I in P2 subdomain.ConclusionThe novel GII.17 strains that caused outbreaks in 2013–2015 may have two new variants. The evolvement of HBGAs binding site and epitopes in P2 subdomain might contribute to the novel GII.17 strains predominance in some regions.

Prediction of protein function using a deep convolutional neural network ensemble

BackgroundThe availability of large databases containing high resolution three-dimensional (3D) models of proteins in conjunction with functional annotation allows the exploitation of advanced supervised machine learning techniques for automatic protein function prediction.MethodsIn this work, novel shape features are extracted representing protein structure in the form of local (per amino acid) distribution of angles and amino acid distances, respectively. Each of the multi-channel feature maps is introduced into a deep convolutional neural network (CNN) for function prediction and the outputs are fused through support vector machines or a correlation-based k-nearest neighbor classifier. Two different architectures are investigated employing either one CNN per multi-channel feature set, or one CNN per image channel.ResultsCross validation experiments on single-functional enzymes (n = 44,661) from the PDB database achieved 90.1% correct classification, demonstrating an improvement over previous results on the same dataset when sequence similarity was not considered.DiscussionThe automatic prediction of protein function can provide quick annotations on extensive datasets opening the path for relevant applications, such as pharmacological target identification. The proposed method shows promise for structure-based protein function prediction, but sufficient data may not yet be available to properly assess the method’s performance on non-homologous proteins and thus reduce the confounding factor of evolutionary relationships.

Chemical composition of preen wax reflects major histocompatibility complex similarity in songbirds.

In jawed vertebrates, genes of the major histocompatibility complex (MHC) play a key role in immunity by encoding cell-surface proteins that recognize and bind non-self antigens. High variability at MHC suggests that these loci may also function in social signalling such as mate choice and kin recognition. This requires that MHC genotype covaries with some perceptible phenotypic trait. In mammals and fish, MHC is signalled chemically through volatile and non-volatile peptide odour cues, facilitating MHC-dependent mate choice and other behaviours. In birds, despite evidence for MHC-dependent mating, candidate mechanisms for MHC signalling remain largely unexplored. However, feather preen wax has recently been implicated as a potential source of odour cues. We examined whether the chemical composition of preen wax correlates with MHC class IIβ genotypes of wild song sparrows (Melospiza melodia). Pairwise chemical distance reflected amino acid distance at MHC for male-female dyads, although not for same-sex dyads. Chemical diversity did not reflect MHC diversity. We used gas chromatography-mass spectrometry (GC-MS) to characterize preen wax compounds, and identified four wax esters that best reflect MHC similarity. Provided songbirds can detect variation in preen wax composition, this cue may allow individuals to assess MHC compatibility of potential mates.

Genetic characterization of influenza viruses from influenza-related hospital admissions in the St. Petersburg and Valencia sites of the Global Influenza Hospital Surveillance Network during the 2013/14 influenza season

BackgroundContinuous surveillance for genetic changes in circulating influenza viruses is needed to guide influenza prevention and control. ObjectivesTo compare intra-seasonal influenza genetic diversity of hemagglutinin in influenza A strains isolated from influenza hospital admissions collected at two distinct sites during the same season. Study designComparative phylogenetic analysis of full-length hemagglutinin genes from 77 isolated influenza A viruses from the St. Petersburg, Russian Federation and Valencia, Spain sites of the Global Influenza Hospital Surveillance Network (GIHSN) during the 2013/14 season. ResultsWe found significant variability in A(H3N2) and A(H1N1)pdm09 viruses between the two sites, with nucleotide variation at antigenic positions much lower for A(H1N1)pdm09 than for A(H3N2) viruses. For A(H1N1)pdm09, antigenic sites differed by three to four amino acids from the vaccine strain, two of them common to all tested isolates. For A(H3N2) viruses, antigenic sites differed by six to nine amino acids from the vaccine strain, four of them common to all tested isolates. A fifth amino acid substitution in the antigenic sites of A(H3N2) defined a new clade, 3C.2. For both influenza A subtypes, pairwise amino acid distances between circulating viruses and vaccine strains were significantly higher at antigenic than at non-antigenic sites. Whereas A(H1N1)pdm09 viruses clustered with clade 6B and 94% of A(H3N2) with clade 3C.3, at both study sites A(H3N2) clade 3C.2 viruses emerged towards the end of the season, showing greater pairwise amino acid distances from the vaccine strain compared to the predominant clade 3C.3. ConclusionsInfluenza A antigenic variants differed between St. Petersburg and Valencia, and A(H3N2) clade 3C.2 viruses were characterized by more amino acid differences from the vaccine strain, especially at the antigenic sites.

Evidence for selection maintaining MHC diversity in a rodent species despite strong density fluctuations.

Strong spatiotemporal variation in population size often leads to reduced genetic diversity limiting the adaptive potential of individual populations. Key genes of adaptive variation are encoded by the immune genes of the major histocompatibility complex (MHC) playing an essential role in parasite resistance. How MHC variation persists in rodent populations that regularly experience population bottlenecks remains an important topic in evolutionary genetics. We analysed the consequences of strong population fluctuations on MHC class II DRB exon 2 diversity in two distant common vole (Microtus arvalis) populations in three consecutive years using a high-throughput sequencing approach. In 143 individuals, we detected 25 nucleotide alleles translating into 14 unique amino acid MHC alleles belonging to at least three loci. Thus, the overall allelic diversity and amino acid distance among the remaining MHC alleles, used as a surrogate for the range of pathogenic antigens that can be presented to T-cells, are still remarkably high. Both study populations did not show significant population differentiation between years, but significant differences were found between sites. We concluded that selection processes seem to be strong enough to maintain moderate levels of MHC diversity in our study populations outcompeting genetic drift, as the same MHC alleles were conserved between years. Differences in allele frequencies between populations might be the outcome of different local parasite pressures and/or genetic drift. Further understanding of how pathogens vary across space and time will be crucial to further elucidate the mechanisms maintaining MHC diversity in cyclic populations.

Protective immunity spectrum induced by immunization with a vaccine from the TBEV strain Sofjin

Tick-borne encephalitis (TBE) circulates widely in the territory of Eurasia with up to 10,000 cases registered annually. The TBE virus (TBEV) includes three main subtypes: European, Siberian and Far-Eastern, and two new Asiatic variants, phylogenetically distant from the others. The inactivated antigen of European or Far-Eastern strains is used in commercial TBE vaccines. A set of 14 TBEV strains, isolated in 1937–2008, with different passage histories, representing all subtypes and variants, was used in this work. The chosen set covers almost all the TBE area.Sera of mice, immunized with the TBE vaccine Moscow, prepared from the TBEV strain Sofjin, were studied in a plaque neutralization test against the set of TBEV strains. The vaccine induced antibodies at a protective titer against all TBEV strains and Omsk hemorrhagic fever virus (OHFV) with Е protein amino acid distances of 0.008–0.069, but not against Powassan virus.We showed that after a course of two immunizations, factors such as the period between vaccinations (1–4 weeks), the challenging virus dose (30–1000 LD50) and terms of challenge (1–4 weeks after the last immunization) did not significantly affect the assessment of protective efficacy of the vaccine in vivo. The protective effect of the TBE vaccine Moscow against the set of TBEV strains and the OHFV was demonstrated in in vivo experiments. TBE vaccine Moscow did not protect mice against 10 LD50 of the Powassan virus.We showed that this range of Е protein amino acid distances between the vaccine strain and challenging virus do not have a decisive impact on the TBE vaccine protective effect in vitro and in vivo. Moreover, the TBE vaccine Moscow induces an immune response protective against a wide range of TBEV variants.

İki Ardışık Epidemik Sezonda Ülkemizde Dolaşımda Olan İnsan Metapnömovirus Suşlarının Filogenetik Çeşitliliği

Human metapneumovirus (HMPV), classified in Paramyxoviridae family, phylogenetically consists of two major groups namely A and B, with genetic lineages of A1, A2 (comprises of sublineages A2a and A2b) and B1, B2. Although detailed evaluation on phylogenetic analysis of HMPV has been described in other countries, there are no data from Turkey on this subject. The aim of this study was to demonstrate for the first time, the phylogenetic diversity of HMPV strains circulating in Turkey during two consecutive epidemic seasons. A total of 2900 upper respiratory tract samples collected from patients with respiratory illness were evaluated between January 2011 and December 2013, without any special selection criteria. The presence of respiratory viruses in the samples were detected by real-time multiplex polymerase chain reaction (FTD® Respiratory Pathogens 21 Multiplex RT-PCR, Fast Track Diagnostics, Luxemburg), and 76 (2.6%) samples positive for HMPV were included in the study. HPMV nucleocapsid (N) (nt: 454-878) and fusion (F) (nt: 3624-4130) genes were selected for phylogenetic analysis. In sequence analysis, F and N gene sequences could only be obtained successfully from 46 out of 76 HMPV positive samples. According to sequences obtained, 54.3% belonged to B2, 17.4% to B1, 4.3% to A1, 4.3% to A2a, and 20% to A2b. In 2011, the A2b sublineage was predominant, while in 2012 and 2013, B2 lineages were predominant together with the B1 lineage. The A1 lineage was observed only in 2013. For the F gene fragment, nucleotide distance between group A and B was in the range of 0.138-0.168, however aminoacid distance amongst Turkish HMPV sequences were in the range of 0.028-0.042. For the N gene fragment, nucleotide distance between group A and B was in the range of 0.141-0.163, but aminoacid distance between group A and B was in the range of 0.037-0.050. Nucleotide diversity was higher than aminoacid diversity between and within lineages found in this study. This result indicated that the functional constraints on F and N genes prevent dramatic aminoacid changes, and indicated that the evolution of HMPV was slow. The seasonal peaks were observed from April to July in 2011, from January to June in 2012 and from January to May in 2013. In addition, our data emphasized that the HMPV prevalence was high in children 0-5 years old, and coinfections were common with the other respiratory viruses such as respiratory syncytial virus, coronavirus, parainfluenza virus 3, rhinovirus and enterovirus. In conclusion, this study showed that HMPV strains circulating in Turkey were similar to those circulating in Europe.

Influence of the ionic liquid [C4mpy][Tf2N] on the structure of the miniprotein Trp-cage

We examine the effect of the ionic liquid [C4mpy][Tf2N] on the structure of the miniprotein Trp-cage and contrast these results with the behavior of Trp-cage in water. We find the ionic liquid has a dramatic effect on Trp-cage, though many similarities with aqueous Trp-cage are observed. We assess Trp-cage folding by monitoring root mean square deviation from the crystallographic structure, radius of gyration, proline cis/trans isomerization state, protein secondary structure, amino acid contact formation and distance, and native and non-native contact formation. Starting from an unfolded configuration, Trp-cage folds in water at 298K in less than 500ns of simulation, but has very little mobility in the ionic liquid at the same temperature, which can be ascribed to the higher ionic liquid viscosity. At 365K, the mobility of the ionic liquid is increased and initial stages of Trp-cage folding are observed, however Trp-cage does not reach the native folded state in 2μs of simulation in the ionic liquid. Therefore, in addition to conventional molecular dynamics, we also employ scaled molecular dynamics to expedite sampling, and we demonstrate that Trp-cage in the ionic liquid does closely approach the aqueous folded state. Interestingly, while the reduced mobility of the ionic liquid is found to restrict Trp-cage motion, the ionic liquid does facilitate proline cis/trans isomerization events that are not seen in our aqueous simulations.

Mitochondrial Genome Analyses Suggest Multiple Trichuris Species in Humans, Baboons, and Pigs from Different Geographical Regions.

BackgroundThe whipworms Trichuris trichiura and Trichuris suis are two parasitic nematodes of humans and pigs, respectively. Although whipworms in human and non-human primates historically have been referred to as T. trichiura, recent reports suggest that several Trichuris spp. are found in primates.Methods and FindingsWe sequenced and annotated complete mitochondrial genomes of Trichuris recovered from a human in Uganda, an olive baboon in the US, a hamadryas baboon in Denmark, and two pigs from Denmark and Uganda. Comparative analyses using other published mitochondrial genomes of Trichuris recovered from a human and a porcine host in China and from a françois’ leaf-monkey (China) were performed, including phylogenetic analyses and pairwise genetic and amino acid distances. Genetic and protein distances between human Trichuris in Uganda and China were high (~19% and 15%, respectively) suggesting that they represented different species. Trichuris from the olive baboon in US was genetically related to human Trichuris in China, while the other from the hamadryas baboon in Denmark was nearly identical to human Trichuris from Uganda. Baboon-derived Trichuris was genetically distinct from Trichuris from françois’ leaf monkey, suggesting multiple whipworm species circulating among non-human primates. The genetic and protein distances between pig Trichuris from Denmark and other regions were roughly 9% and 6%, respectively, while Chinese and Ugandan whipworms were more closely related.Conclusion and SignificanceOur results indicate that Trichuris species infecting humans and pigs are phylogenetically distinct across geographical regions, which might have important implications for the implementation of suitable and effective control strategies in different regions. Moreover, we provide support for the hypothesis that Trichuris infecting primates represents a complex of cryptic species with some species being able to infect both humans and non-human primates.

SPECTRUS: A Dimensionality Reduction Approach for Identifying Dynamical Domains in Protein Complexes from Limited Structural Datasets

Identifying dynamical, quasi-rigid domains in proteins provides a powerful means for characterizing functionally oriented structural changes via a parsimonious set of degrees of freedom. In fact, the relative displacements of few dynamical domains usually suffice to rationalize the mechanics underpinning biological functionality in proteins and can even be exploited for structure determination or refinement purposes. Here we present SPECTRUS, a general scheme that, by solely using amino acid distance fluctuations, can pinpoint the innate quasi-rigid domains of single proteins or large complexes in a robust way. Consistent domains are usually obtained by using either a pair of representative structures or thousands of conformers. The functional insights offered by the approach are illustrated for biomolecular systems of very different size and complexity such as kinases, ion channels, and viral capsids. The decomposition tool is available as a software package and web server at spectrus.sissa.it.

MHC class II-assortative mate choice in European badgers (Meles meles).

The major histocompatibility complex (MHC) plays a crucial role in the immune system, and in some species, it is a target by which individuals choose mates to optimize the fitness of their offspring, potentially mediated by olfactory cues. Under the genetic compatibility hypothesis, individuals are predicted to choose mates with compatible MHC alleles, to increase the fitness of their offspring. Studies of MHC-based mate choice in wild mammals are under-represented currently, and few investigate more than one class of MHC genes. We investigated mate choice based on the compatibility of MHC class I and II genes in a wild population of European badgers (Meles meles). We also investigated mate choice based on microsatellite-derived pairwise relatedness, to attempt to distinguish MHC-specific effects from genomewide effects. We found MHC-assortative mating, based on MHC class II, but not class I genes. Parent pairs had smaller MHC class II DRB amino acid distances and smaller functional distances than expected from random pairings. When we separated the analyses into within-group and neighbouring-group parent pairs, only neighbouring-group pairs showed MHC-assortative mating, due to similarity at MHC class II loci. Our randomizations showed no evidence of genomewide-based inbreeding, based on 35 microsatellite loci; MHC class II similarity was therefore the apparent target of mate choice. We propose that MHC-assortative mate choice may be a local adaptation to endemic pathogens, and this assortative mate choice may have contributed to the low MHC genetic diversity in this population.

No evidence for MHC class I‐based disassortative mating in a wild population of great tits

Genes of the major histocompatibility complex (MHC) are regarded as a potentially important target of mate choice due to the fitness benefits that may be conferred to the offspring. According to the complementary genes hypothesis, females mate with MHC dissimilar males to enhance the immunocompetence of their offspring or to avoid inbreeding depression. Here, we investigate whether selection favours a preference for maximally dissimilar or optimally dissimilar MHC class I types, based on MHC genotypes, average amino acid distances and the functional properties of the antigen-binding sites (MHC supertypes); and whether MHC type dissimilarity predicts relatedness between mates in a wild great tit population. In particular, we explore the role that MHC class I plays in female mate choice decisions while controlling for relatedness and spatial population structure, and examine the reproductive fitness consequences of MHC compatibility between mates. We find no evidence for the hypotheses that females select mates on the basis of either maximal or optimal MHC class I dissimilarity. A weak correlation between MHC supertype sharing and relatedness suggests that MHC dissimilarity at functional variants may not provide an effective index of relatedness. Moreover, the reproductive success of pairs did not vary with MHC dissimilarity. Our results provide no support for the suggestion that selection favours, or that mate choice realizes, a preference for complimentary MHC types.