Amino Acid Identity Research Articles

Genome-Resolved Metagenomics and Metatranscriptomics Reveal Insights into the Ecology and Metabolism of Anaerobic Microbial Communities in PCB-Contaminated Sediments.

Growth of organohalide-respiring bacteria such as Dehalococcoides mccartyi on halogenated organics (e.g., polychlorinated biphenyls (PCBs)) at contaminated sites or in enrichment culture requires interaction and support from other microbial community members. To evaluate naturally occurring interactions between Dehalococcoides and key supporting microorganisms (e.g., production of H2, acetate, and corrinoids) in PCB-contaminated sediments, metagenomic and metatranscriptomic sequencing was conducted on DNA and RNA extracted from sediment microcosms, showing evidence of both Dehalococcoides growth and PCB dechlorination. Using a genome-resolved approach, 160 metagenome-assembled genomes (MAGs), including three Dehalococcoides MAGs, were recovered. A novel reductive dehalogenase gene, distantly related to the chlorophenol dehalogenase gene cprA (pairwise amino acid identity: 23.75%), was significantly expressed. Using MAG gene expression data, 112 MAGs were assigned functional roles (e.g., corrinoid producers, acetate/H2 producers, etc.). A network coexpression analysis of all 160 MAGs revealed correlations between 39 MAGs and the Dehalococcoides MAGs. The network analysis also showed that MAGs assigned with functional roles that support Dehalococcoides growth (e.g., corrinoid assembly, and production of intermediates required for corrinoid synthesis) displayed significant coexpression correlations with Dehalococcoides MAGs. This work demonstrates the power of genome-resolved metagenomic and metatranscriptomic analyses, which unify taxonomy and function, in investigating the ecology of dehalogenating microbial communities.

Lactococcus lactis CNCM I-5388 versus NCDO2118 by its GABA hyperproduction ability, counteracts faster stress-induced intestinal hypersensitivity in rats.

Irritable bowel syndrome (IBS) is a functional gastrointestinal disorder characterized by its main symptom, visceral hypersensitivity (VH), which is aggravated by stress. Gut-brain interactions and gut bacteria may alleviate IBS symptoms, including VH. γ-amino butyric acid (GABA), produced notably by lactic acid bacteria (LAB), shows promising result in IBS symptoms treatment. In bacteria, GABA is generated through glutamate decarboxylase (GAD) metabolism of L-glutamic acid, maintaining intracellular pH. In mammals, GABA acts as an inhibitory neurotransmitter, modulating pain, stress, and anxiety. Therefore, utilizing GABA-producing LAB as a therapeutic approach might be beneficial. Our previous work showed that a GABA-producing Lactococcus lactis strain, NCDO2118, reduced VH induced by acute stress in rats after a 10-day oral treatment. Here, we identified the strain CNCM I-5388, with a four-fold higher GABA production rate under the same conditions as NCDO2118. Both strains shared 99.1% identical GAD amino acid sequences and invitro analyses revealed the same optimal pH for GAD activity; however, CNCM I-5388 exhibited 17 times higher intracellular GAD activity and increased resistance to acidic pH. Additionally, invivo experiments have demonstrated that CNCM I-5388 has faster anti-VH properties in rats compared with NCDO2118, starting from the fifth day of treatment. Finally, CNCM I-5388 anti-VH effects partially persisted after 5-day treatment interruption and after a single oral treatment. These findings highlight CNCM I-5388 as a potential therapeutic agent for managing VH in IBS patients.

Identification and characterization of a novel 6'-N-aminoglycoside acetyltransferase AAC(6')-Va from a clinical isolate of Aeromonas hydrophila.

Aeromonas species have been identified as agents responsible for various diseases in both humans and animals. Multidrug-resistant Aeromonas strains pose a significant public health threat due to their emergence and spread in clinical settings and the environment. The aim of this study was to determine a novel resistance mechanism against aminoglycoside antimicrobials in a clinical isolate. The function of aac(6')-Va was verified by gene cloning and antibiotic susceptibility tests. To explore the in vivo activity of the enzyme, recombinant proteins were expressed, and enzyme kinetics were tested. To determine the molecular background and mechanism of aac(6')-Va, whole-genome sequencing and bioinformatic analysis were performed. The novel aminoglycoside N-acetyltransferase gene aac(6')-Va confers resistance to several aminoglycosides. Among the antimicrobials tested, ribostamycin showed the highest increase (128-fold) in the minimum inhibitory concentration (MIC) compared with the control strains. According to the MIC results of the cloned aac(6')-Va, AAC(6')-Va also showed the highest catalytic efficiency for ribostamycin [kcat/Km ratio = (3.35 ± 0.17) × 104 M-1 s-1]. Sharing the highest amino acid identity of 54.68% with AAC(6')-VaIc, the novel aminoglycoside N-acetyltransferase constituted a new branch of the AAC(6') family due to its different resistance profiles. The gene context of aac(6')-Va and its close relatives was conserved in the genomes of species of the genus Aeromonas. The novel resistance gene aac(6')-Va confers resistance to several aminoglycosides, especially ribostamycin. Our finding of a novel resistance gene in clinical A. hydrophila will help us develop more effective treatments for this pathogen's infections.

Comparative genomics reveals environmental adaptability and antimicrobial activity of a novel Streptomyces isolated from soil under black Gobi rocks.

A novel Streptomyces strain, designated 3_2T, was isolated from soil under the black Gobi rock sample of Northwest China. The taxonomic position of this strain was revealed by a polyphasic approach. Comparative analysis of the 16S rRNA gene sequences indicated that 3_2T was closely related to the members of the genus Streptomyces, with the highest similarity to Streptomyces rimosus subsp. rimosus CGMCC 4.1438 (99.17%), Streptomyces sioyaensis DSM 40032 (98.97%). Strain 3_2T can grow in media up to 13% NaCl. The genomic DNA G + C content of strain 3_2T was 69.9%. We obtained the genomes of 22 Streptomyces strains similar to strain 3_2T, compared the average nucleotide similarity, dDDH and average amino acid identity, and found that the genomic similarity of the new isolate 3_2T to all strains was below the threshold for interspecies classification. Chemotaxonomic data revealed that strain 3_2T possessed MK-9 (H6) and MK-9 (H8) as the major menaquinones. The cell wall contained LL-diaminopimelic acid (LL-DAP) and the whole-cell sugars were ribose and glucose. The major fatty acid methyl esters were iso-C16:0 (23.6%) and anteiso-C15:0 (10.4%). The fermentation products of strain 3_2T were inhibitory to Staphylococcus aureus and Bacillus thuringiensi. The genome of 3_2T was further predicted using anti-smash and the strain was found to encode the production of 41 secondary metabolites, and these gene clusters may be key to the good inhibitory activity exhibited by the strain. Genomic analysis revealed that strain 3_2T can encode genes that produce a variety of genes in response to environmental stresses, including cold shock, detoxification, heat shock, osmotic stress, oxidative stress, and these genes may play a key role in the harsh environment in which the strain can survive. Therefore, this strain represents a novel Streptomyces species, for which the name Streptomyces halobius sp. nov. is proposed. The type strain is 3_2T (= JCM 34935T = GDMCC 4.217T).

Pyrofollis japonicus gen. nov. sp. nov., a novel member of the family Pyrodictiaceae isolated from the Iheya North hydrothermal field.

A novel hyperthermophilic, heterotrophic archaeon, strain YC29T, was isolated from a deep-sea hydrothermal vent in the Mid-Okinawa Trough, Japan. Cells of strain YC29T were non-motile, irregular cocci with diameters of 1.2-3.0µm. The strain was an obligatory fermentative anaerobe capable of growth on complex proteinaceous substrates. Growth was observed between 85 and 100°C (optimum 90-95°C), pH 4.9-6.4 (optimum 5.1), and in the presence of 1.4-4.0% (w/v) NaCl (optimum 3.0%). Inorganic carbon was required as a carbon source. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that the isolate was a member of the family Pyrodictiaceae. The genome size was 2.02 Mbp with a G+C content of 49.4%. The maximum values for average nucleotide identity (ANI), average amino acid identity (AAI), and in silico DNA-DNA hybridization (dDDH) value of strain YC29T with relatives were 67.9% (with Pyrodictium abyssi strain AV2T), 61.1% (with Pyrodictium occultum strain PL-19T), and 33.8% (with Pyrolobus fumarii strain 1AT), respectively. Based on the phylogenetic, genomic, and phenotypic characteristics, we propose that strain YC29T represents a novel genus and species, Pyrofollis japonicus gen. nov., sp. (type strain YC29T = DSM 113394T = JCM 39171T).

The influence of Spirulina extract on pathogenicity, immune response, and vaccine efficacy against H9N2 avian influenza virus in specific pathogen free chickens

Avian influenza (AI) viruses pose a risk to the worldwide poultry industry. Ultimately, improving the efficiency of the H9N2 vaccine is necessary to better control low-pathogenic avian influenza-H9N2 by using natural immunostimulant. Therefore, the goal of the present study was to examine varying doses of the cyanobacterium Spirulina extract on the effectiveness of H9N2 vaccine. Thus, a total of 150 specific pathogen-free (SPF) chickens were allocated into 6 groups, 25 birds each, as follow: G1, G2, and G6 were supplemented with 200, 400, and 400 mg Spirulina extract/kg feed, respectively, whilst the feed in G3, G4, and G5 were not supplemented with Spirulina extract. At 21-days-old, only the chickens in G1, G2, and G3 were vaccinated with the H9N2 AI vaccine. After 4 wk postvaccination, the chickens in G1, G2, G3, G4, and G6 were challenged with H9N2 AI Egyptian strain. The challenged virus was selected from a recent circulating Egyptian strain during 2022, and it was related to A/quail/Hong Kong/G1/97-like virus lineage and clustered with G1-B sub-lineage EGY-2 group. It had a high amino acids identity percentage of 92.6% with the A/chicken/Iran/av1221/1998 (Boehringer Ingelheim) vaccine. The results of real-time reverse-transcriptase polymerase-chain-reaction (rRT-PCR) revealed that no shedding of the virus was reported in G1, G2, G3, and G5. The supplementation of Spirulina extract in low (200 mg/kg of feed) and high (400 mg/kg of feed) concentration with the birds vaccinated with H9N2 AI vaccine (G1 and G2) induced prominent immuno-stimulatory effect in a dose dependent manner where it strongly enhanced the phagocytic activities of broilers' peripheral blood monocytes, and lysozyme at all days postvaccination (dpv) and days postchallenge (dpc) compared to other groups with significant differences at all day of experiment and 21st dpv, 28th dpv, 7th dpc, and 14th dpc, respectively. The supplementation with Spirulina extract in G1 and G2 induced the highest hemagglutination inhibition antibody titer in a dose-dependent manner at all-time intervals. The antibody titer postvaccination was significantly increased in G1 and G2 at 14th, and 21st dpv, in comparison with G3. Furthermore, G1 and G2 showed higher significant antibody titers at 7th and 14th dpc, compared to other groups. Furthermore, Spirulina extract (200 and 400 mg/kg feed) in G1 and G2 showed anti-inflammatory effect in a dose dependant manner by downregulating nitric oxide levels at all times postchallenge with a significant difference at 3 to 7 dpc compared to G3, G4, and G6, with improved histopathological alterations in the trachea, lung, kidney, spleen, and bursa of Fabricius. G6 supplied with 400 mg/kg Spirulina extract feed only without vaccination had a similar effect as vaccinated groups on innate immunity. However, it delayed the production of antibodies and did not prevent viral shedding as in vaccinated groups. In conclusion, vaccination in conjunction with either dose of Spirulina extract (G1, and G2) prevents viral shedding, increases the immune response, and reduces inflammation and histopathological change caused by H9N2 AI infection in a dose dependent manner. We recommend the use of 400 mg Spirulina extract/kg feed as a natural immunostimulant in conjunction with the H9N2 vaccine to achieve the highest possible level of protection against H9N2 AI infection.

Phenotypic and Genomic Characterization of Streptomyces pakalii sp. nov., a Novel Species with Anti-Biofilm and Anti-Quorum Sensing Activity in ESKAPE Bacteria.

The increasing number of infections caused by antimicrobial multi-resistant microorganisms has led to the search for new microorganisms capable of producing novel antibiotics. This work proposes Streptomyces pakalii sp. nov. as a new member of the Streptomycetaceae family. The strain ENCB-J15 was isolated from the jungle soil in Palenque National Park, Chiapas, Mexico. The strain formed pale brown, dry, tough, and buried colonies in the agar with no diffusible pigment in GAE (glucose-asparagine-yeast extract) medium. Scanning electron micrographs showed typical mycelium with long chains of smooth and oval-shaped spores (3-10 m). The strain grew in all of the International Streptomyces Project (ISP)'s media at 28-37 °C with a pH of 6-9 and 0-10% NaCl. S. pakalii ENCB-J15 assimilated diverse carbon as well as organic and inorganic nitrogen sources. The strain also exhibited significant inhibitory activity against the prodigiosin synthesis of Serratia marcescens and the inhibition of the formation and destruction of biofilms of ESKAPE strains of Acinetobacter baumannii and Klebsiella pneumoniae. The draft genome sequencing of ENCB-J15 revealed a 7.6 Mb genome with a high G + C content (71.6%), 6833 total genes, and 6746 genes encoding putative proteins. A total of 26 accessory clusters of proteins associated with carbon sources and amino acid catabolism, DNA modification, and the antibiotic biosynthetic process were annotated. The 16S rRNA gene phylogeny, core-proteome phylogenomic tree, and virtual genome fingerprints support that S. pakalii ENCB-J15 is a new species related to Streptomyces badius and Streptomyces globisporus. Similarly, its average nucleotide identity (ANI) (96.4%), average amino acid identity (AAI) (96.06%), and virtual DNA-DNA hybridization (67.3%) provide evidence to recognize it as a new species. Comparative genomics revealed that S. pakalli and its closest related species maintain a well-conserved genomic synteny. This work proposes Streptomyces pakalii sp. nov. as a novel species that expresses anti-biofilm and anti-quorum sensing activities.

Genome-based reclassification of Kitasatospora niigatensis as a later heterotypic synonym of Kitasatospora cineracea Tajima et al. (2001).

The present study used genome-based approaches to investigate the taxonomic relationship between Kitasatospora cineracea DSM 44780T and Kitasatospora niigatensis DSM 44781T, two species that were previously described by Tajima et al. (Int J Syst Evol Microbiol 51:1765-1771, 2001). The digital DNA-DNA hybridization (dDDH), average amino acid identity (AAI), and average nucleotide identity (ANI) values between the genomes of the two type strains were 90.3, 98.7, and 99.1%, respectively. These values exceeded the established thresholds of 70% (dDDH) and 95-96% (ANI and AAI) for bacterial species delineation, suggesting that K. cineracea and K. niigatensis should share the same taxonomic position. Furthermore, our analysis using the 'Bacterial Pan Genome Analysis' (BPGA) pipeline and the Maximum Likelihood core-genes tree inferred using FastTree2 consistently demonstrated that K. cineracea DSM 44780T and K. niigatensis DSM 44781T are closely related, as indicated by the clustering of these strains in the core-genes phylogenomic tree. Based on these findings, we propose that K. niigatensis should be considered a later heterotypic synonym of K. cineracea.

Trypanosoma cruzi Fibrillarins: Two paralogous proteins with non-identical signals for nuclear transport

Trypanosoma cruzi is a parasitic protozoa causative of Chagas disease. As part of our interest in studying the basic biology of this microorganism, this work reports our observations related to the characterization of motifs and structural domains present in two fibrillarin isoforms (TcFib1 and TcFib2) that were found to be necessary for the nuclear targeting of these nucleolar proteins. Previous characterization of these proteins indicated that they share 68.67% of identical amino acids and are both expressed as nucleolar proteins in T. cruzi epimastigotes. Using an approach based on the transfection of recombinant genes encoding fluorescent fibrillarin-EGFP fusion proteins, this study found evidence for the presence of 4 motifs or protein domains that help target these proteins to the nucleus: The GAR domain and carboxyl terminus in both TcFibs, as well as two lysines and a computationally predicted cNLS in TcFib1. As a distinctive feature, the GAR domain of TcFib2 proved to be essential for the nuclear localization of this protein paralog. Such a difference between TcFib1 and Tcfib2 nuclear localization signals can be explained as the presence of two partially related nuclear import pathways for the two fibrillarin homologues in this organism.

Galbibacter pacificus sp. nov., isolated from surface seawater of the western Pacific Ocean and transfer of Joostella marina to the genus Galbibacter as Galbibacter orientalis nom. nov. and emended description of the genus Galbibacter.

Two Gram-stain-negative, non-motile, non-spore-forming, strictly aerobic and rod-shaped bacterial strains, CMA-7T and CAA-3, were isolated from surface seawater samples collected from the western Pacific Ocean. Phylogeny of 16S rRNA gene sequences indicated they were related to the genera Galbibacter and Joostella and shared 95.1, 90.9 and 90.8% sequence similarity with G. mesophilus Mok-17T, J. marina DSM 19592T and G. marinus ck-I2-15T, respectively. Phylogenomic analysis showed that the two strains, together with the members of the genera Galbibacter and Joostella, formed a monophyletic clade that could also be considered a monophyletic taxon. This distinctiveness was supported by amino acid identity and percentage of conserved proteins indices, phenotypic and chemotaxonomic characteristics and comparative genomics analysis. Digital DNA‒DNA hybridization values and average nucleotide identities between the two strains and their closest relatives were 18.0-20.8 % and 77.7-79.3 %, respectively. The principal fatty acids were iso-C15 : 0, iso-C17 : 0 3-OH, iso-C15 : 1 G, Summed Feature 3 (C16 : 1 ω7c/C16 : 1 ω6c or C16 : 1 ω6c/C16 : 1 ω7c), Summed Feature 9 (iso-C17 : 1 ω9c or C16 : 0 10-methyl), and C15 : 0 3-OH. The predominant respiratory quinone was MK-6. The polar lipids were phosphatidylethanolamine, aminolipid, aminophospholipid, phospholipid, phosphoglycolipid, glycolipid and unknown polar lipid. The genomic DNA G+C content of strains CMA-7T and CAA-3 was both 38.4 mol%. Genomic analysis indicated they have the potential to degrade cellulose and chitin. Based on the polyphasic evidence presented in this study, the two strains represent a novel species within the genus Galbibacter, for which the name Galbibacter pacificus sp. nov. is proposed. The type strain is CMA-7T (=MCCC M28999T = KCTC 92588T). Moreover, the transfer of Joostella marina to the genus Galbibacter as Galbibacter orientalis nom. nov. (type strain En5T = KCTC 12518T = DSM 19592T=CGMCC 1.6973T) is also proposed.

Mycobacteriales taxonomy using network analysis-aided, context-uniform phylogenomic approach for non-subjective genus demarcation.

A robust taxonomy is essential for the organized study of prokaryotes and the effective communication of microbial knowledge. The genus rank is the mainstay of biological classification as it brings together under a common name a group of closely related organisms sharing the same recent ancestry and similar characteristics. Despite the unprecedented resolution afforded by whole-genome sequencing in defining evolutionary relationships, a consensus approach for phylogenomics-based prokaryotic genus delineation remains elusive. Taxonomists use different demarcation criteria, sometimes leading to genus rank over-splitting and the creation of multiple new genera. This work reports a simple, reliable, and standardizable method that seeks to minimize subjectivity in genomics-based demarcation of prokaryotic genera, exemplified through application to the order Mycobacteriales. Formal descriptions of proposed taxonomic changes based on our study are included.

Polycladospora coralii gen. nov., sp. nov., a novel member of the family Thermoactinomycetaceae isolated from stony coral in the South China Sea.

Two novel filamentous bacteria, designated as IB182353T and IB182357, were isolated from stony coral of the South China Sea. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strains IB182353T and IB182357 were closely related to Hazenella coriacea DSM 45707T (with 93.4 and 93.5% similarity, respectively). The average nucleotide identity, average amino acid identity and digital DNA-DNA hybridization results showed that the pairwise similarities between isolate IB182353T and the other recognized Thermoactinomycetaceae species were less than 68.9, 60.5 and 21.1 %, respectively. Both strains produced aerial and substrate mycelia, grew optimally at 25-30 °C, pH 8.0-9.0 and with 2-3 % (w/v) NaCl. The cell-wall peptidoglycan type was meso-DAP and the whole-cell hydrolysates contained ribose. The polar lipids consisted of phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol, one unidentified aminophospholipid and three unidentified phospholipids. The genomic DNA G+C content was 39.5 mol%. Strain IB182353T was distinguishable from its related type strains by the contents of two fatty acids, iso-C15 : 0 and iso-C17 : 1 ω10c. Based on polyphasic taxonomic characterization, we propose that strains IB182353T and IB182357 represent a novel genus and species within the family Thermoactinomycetaceae, for which the name Polycladospora coralii gen. nov. sp. nov. is proposed. The type strain is IB182353T (=MCCC 1K04631T=JCM 34206T).

Segregated localization of two calponin-related proteins within sarcomeric thin filaments in Caenorhabditis elegans striated muscle.

The calponin family proteins are expressed in both muscle and non-muscle cells and involved in the regulation of cytoskeletal dynamics and cell contractility. In the nematode Caenorhabditis elegans, UNC-87 and CLIK-1 are calponin-related proteins with 42% identical amino acid sequences containing seven calponin-like motifs. Genetic studies demonstrated that UNC-87 and CLIK-1 have partially redundant function in regulating actin cytoskeletal organization in striated and non-striated muscle cells. However, biochemical studies showed that UNC-87 and CLIK-1 are different in their ability to bundle actin filaments. In this study, I extended comparison between UNC-87 and CLIK-1 and found additional differences in vitro and in vivo. Although UNC-87 and CLIK-1 bound to actin filaments similarly, UNC-87, but not CLIK-1, bound to myosin and inhibited actomyosin ATPase in vitro. In striated muscle, UNC-87 and CLIK-1 were segregated into different subregions within sarcomeric actin filaments. CLIK-1 was concentrated near the actin pointed ends, whereas UNC-87 was enriched toward the actin barbed ends. Restricted localization of UNC-87 was not altered in a clik-1-null mutant, suggesting that their segregated localization is not due to competition between the two related proteins. These results suggest that the two calponin-related proteins have both common and distinct roles in regulating actin filaments.

Whole Genome Sequencing of Infectious Bursal Disease Viruses Isolated from a Californian Outbreak Unravels the Underlying Virulence Markers and Highlights Positive Selection Incidence.

Outbreaks of the immunosuppressive infectious bursal disease (IBD) are frequently reported worldwide, despite the vaccination regimes. A 2009 Californian IBD outbreak caused by rA and rB isolates was described as very virulent (vv) IBD virus (IBDV); however, molecular factors beyond this virulence were not fully uncovered. Therefore, segments of both isolates were amplified, successfully cloned, whole genome sequenced by Next Generation Sequencing, genotyped, and the leading virulence factors were entirely investigated in terms of phylogenetic and amino acid analysis and protein modeling for positive selection orientation and interaction analysis. rA and rB isolates displayed the highest amino acid identity (97.84-100%) with Genotype 3 strains. Interestingly, rA and rB contained all virulence hallmarks of hypervariable (HVR), including 222A, 242I, 249Q, 256I, 284A, 286T, 294I, 299S, and 318G, as well as the serine-rich heptapeptide sequence. Moreover, we pinpointed the A3B2 genotype of rA and rB, predominant in non-reassortants, and we highlighted the absence of recombination events. Furthermore, gene-wise phylogenetic analysis showed the entire genes of rA and rB clustered with the vvIBDVs and emphasized their share in IBDV virulence. VP5 showed a virulence marker, MLSL (amino acid sequence). VP2 encountered three significant novel mutations apart from the HVR, including G163E in rA and Y173C and V178A in rB, all residing within interacting motifs. VP4 contained 168Y, 173N, 203S, and 239D characteristic for the vv phenotype. A235V mutation was detected at the dsRNA binding domain of VP3. In VP1, the TDN triplet and the mutation (V4I) were detected, characteristic of hypervirulence occurring at the N-terminus responsible for protein priming. Although selection analysis revealed seven sites, codon 222 was the only statistically significant selection site. The VP2 modeling of rA and rB highlighted great structure fitness, with 96.14% Ramachandran favored positioning including the 222A, i.e., not influencing the structure stability. The 222A was found to be non-interface surface residue, associated with no interaction with the attachment-mediated ligand motif. Our findings provide pivotal insights into the evolution and underlying virulence factors and will assist in the development of control strategies via sequence-based continuous monitoring for the early detection of novel vv strains.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

First report of Fig virus B in Ficus carica in New Zealand.

Fig (Ficus carica) has been cultivated since ancient times, and is now grown worldwide, both for its fruit and as an ornamental plant. Several viruses and viroids are associated with Fig mosaic disease (FMD), a disease complex occurring worldwide (Preising et al. 2021). Fig mosaic virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig mild mottle-associated virus (FMMaV), and fig badnavirus 1 (FBV-1) are known to infect fig in New Zealand (Minafra et al. 2012; Veerakone et al. 2015). In December 2020, leaf samples from a fig tree growing on the roadside at St Heliers, Auckland, showing dieback with foliar chlorotic mosaic symptoms, was received for virus testing. Total nucleic acid was extracted from the symptomatic leaves using a KingFisher™ mL Purification System (Thermofisher Scientific, Waltham, MA) with an InviMag Plant DNA Mini Kit (Invitek Molecular GmbH, Germany) and subjected to high-throughput sequencing on an Oxford Nanopore Technologies MinION device using the method described in Liefting et al. 2021. All sequence analysis was performed using Geneious Prime 2021.1.1 (https://www.geneious.com). A total of 355,858 reads that passed quality check were subjected to BLASTn search against the NCBI nt database as described in Liefting et al. 2021. The following viruses produced hits: FMV, FBV-1, FMMaV and a fig closterovirus. The presence of FMV, FBV-1 and FMMaV were confirmed by species specific RT-PCRs. To identify the closterovirus, reads were mapped to closteroviruses reported in fig including the recently identified tentative species fig virus A (FiVA; GenBank accession no MN817232) and fig virus B (FiVB; GenBank accession no. MN817233). Five viral contigs ranging from 939 to 2,340 nucleotides (nt) were obtained from mapping to FiVB. Subsequently, a 6.4 kb sequence (GenBank accession no. OQ968551) from the 3' region of the NZ isolate was amplified by overlapping RT-PCR using primers designed from the contig sequences. The sequence shared 79.5% nucleotide (nt) identity with FiVB The original sample and a further 25 symptomatic and 10 asymptomatic fig samples, collected from the Auckland area between 2016 and 2021, were tested using FiVB specific RT-PCR and Sanger sequencing using primers FiVB-F1 (5'-GAGGGAGAGATGTAGATGC-3') and FiVB-R2 (5'-TGTCGTCGATATCGTTGTGT-3'), designed to amplify a 725 nt fragment in the 70 kDa heat shock protein (HSP70) ORF. Products of the expected size were amplified from the original sample and three symptomatic samples and their sequences found to be identical. BLAST searches showed that the sequence (GenBank accession no. ON553403) shared 82.7% nt and 87.3% amino acid (aa) identity to an isolate of FiVB (GenBank accession no MN817233). These additional positive samples were collected from a small home nursery where the plants were propagated from cuttings and have been distributed locally, suggesting the virus is very likely to have a limited spread throughout the Auckland area. All three FiVB infected samples were also positive for FMV. However, the association of FiVB with FMD symptoms is unknown. FiVB was first identified from a latex sample exuded from a fig tree collected from Japan (Park et al. 2021) and is the only report of FiVB in the world to date. Although an identical sequence from Argentina, named fig closterovirus 1, was submitted to GenBank, the origin of this isolate is not known. To our knowledge, this is the first report of FiVB in New Zealand.

Emticicia fluvialis sp. nov., a potential hormone-degrading bacterium isolated from Nakdong River, Republic of Korea.

A novel species of the genus Emticicia, designated BHSR1T, was isolated from a water sample that was collected from the Nakdong River, Republic of Korea, and its taxonomic affiliation was studied using a polyphasic approach. This bacterium was Gram-stain-negative, non-motile, aerobic, curved, rod-shaped, and oxidase- and catalase-negative. The bacterium grew optimally at 37°C, pH 7.5 and 0% (w/v) NaCl. Phylogenetic analyses based on 16S rRNA gene sequences indicated that strain BHSR1T should be affiliated with the genus Emticicia, with a high similarity to Emticicia fontis KCTC 52248T (98.10%). Phylogenomic analysis also suggested that the strain represents a novel species in the genus Emticicia. The genomic G + C content was 41.9%. The average nucleotide identity, average amino acid identity and digital DNA-DNA hybridization between strain BHSR1T and its closely related relatives in the genus Emticicia were in ranges of 71.1-75.8%, 69.4-77.5% and 18.6-19.9%, respectively. The gene cluster within BHSR1T contained genes encoding enzymes that could be involved in hormone degradation. The major cellular fatty acids (> 10%) were summed feature 3 (comprising C16:1ω6c and/or C16:1ω7c) and iso-C15:0. With regards to the polar lipid profile, phosphatidylethanolamine (PE), two unidentified aminolipids and three unidentified lipids were identified as the major compounds. The major respiratory quinone was menaquinone (MK)-7. Based on its phylogenetic, phenotypic, chemotaxonomic, and genomic features, strain BHSR1T should be considered a novel species in the genus Emticicia of the family Spirosomaceae, for which the name Emticicia fluvialis sp. nov. is proposed. The type strain was considered BHSR1T (= KCTC 92622T = GDMCC 1.3740T).

Porcine Circovirus Type 3: Diagnostics, Genotyping, and Challenges in Vaccine Development

Porcine circovirus (PCV) comprises four distinct species, namely, PCV1–4, with considerable differences between them, resulting in limited crossprotection. PCV2 inflicts substantial economic losses on the swine industry. PCV3 was found to have been circulating before its discovery in 2015. PCV3 is suspected of having a comparable impact to PCV2; however, its characterization studies are still underway. The symptoms of PCV3 infection are similar to those of PCV2 infection. However, PCV2 and PCV3 share a maximum amino acid identity of only 37%, which partially explains the inadequacy of the PCV2 vaccine in protecting against PCV3 infection. Swift measures must be taken to control PCV3, including vaccine development, as it also poses a threat to swine populations. This review synthesizes the recent findings on PCV3 in comparison with PCV2 and highlights the prevailing challenges encountered in vaccine development. Various strategies and innovative approaches to producing PCV3 vaccines, such as using RNA particle technology and baculovirus vectors, are also discussed. Addressing research gaps in diagnostic methods, viral isolation, and vaccine development is crucial to controlling this virus, which poses a threat to swine populations.

Silvimonas soli sp. nov., a new member of Chromobacteriaceae isolated from soil in Norrbyskär island, Sweden.

A novel bacterial species is described that was isolated from the soil of Norrbyskär island (Sweden). This Gram-negative, facultatively anaerobic and motile rod, designated 17-6T, was classified in the family Chromobacteriaceae, class Betaproteobacteria, and further characterized by a polyphasic approach. Comparative 16S rRNA gene analysis revealed the potential species novelty of the strain, with Silvimonas terrae (98.20 % similarity) and Silvimonas amylolytica (98.13 %) being its closest type strains. The phylogenetic novelty of the isolate at the level of species was confirmed using phylogenetic analyses based on the whole genome: average nucleotide identity values ranged from 79 to 81 %, average amino acid identity values from 75 to 81 % and percentage of conserved proteins values from 69-81 % with the members of genera Silvimonas and Amantichitinum. On the basis of phenotypic, phylogenetic, functional and genotypic analyses, we propose the isolate as the type strain of a novel species within the genus Silvimonas with the designation Silvimonas soli 17-6T (=DSM 115342T=CCM 9308T).

Proposal to transfer Bacillus massiliigorillae to the genus Peribacillus as Peribacillus massiliigorillae comb. nov., and Bacillus sinesaloumensis to the genus Ferdinandcohnia as Ferdinandcohnia sinesaloumensis comb. nov.

The present study was carried out to clarify the taxonomic position of Bacillus massiliigorillae and Bacillus sinesaloumensis. The 16S rRNA gene sequences extracted from the Bacillus sinesaloumensis Marseille-P3516T (FTOX00000000) and Bacillus massiliigorillae G2T (CAVL000000000) genomes showed 98.5 and 99.1% similarity with the type strains of Ferdinandcohnia humi and Peribacillus endoradicis, respectively. The amino acid identity (AAI) values of Bacillus sinesaloumensis Marseille-P3516T were higher with Ferdinandcohnia members, while Bacillus massiliigorillae G2T with Peribacillus members. In phylogenomic and phylogenetic trees, Bacillus sinesaloumensis Marseille-P3516T and Bacillus massiliigorillae G2T clade with members of the genera Ferdinandcohnia and Peribacillus, respectively. Based on the above results, we propose to transfer Bacillus massiliigorillae to the genus Peribacillus as Peribacillus massiliigorillae comb. nov., and Bacillus sinesaloumensis to the genus Ferdinandcohnia as Ferdinandcohnia sinesaloumensis comb. nov.