Alpha 1D Research Articles

A Review of Naftopidil for Treatment of Lower Urinary Tract Symptoms Suggestive of Benign Prostatic Hyperplasia

In this paper, we review reports related to naftopidil since 2011. Naftopidil was approved in Japan as a drug for lower urinary tract symptoms suggestive of benign prostatic hyperplasia (LUTS/BPH) in 1999. It has three times higher affinity for the alpha-1D adrenergic receptor (α1D-AR) than for the alpha-1A adrenergic receptor (α1A-AR). Although there are several α1 adrenoceptor antagonists, the differences among them with regard to their overall efficacy for LUTS/BPH are unclear. The efficacy of naftopidil for storage symptoms is frequently focused on as a central property of the α1D-AR antagonist.

Cooperative Interaction between the Alpha1-Adrenoceptors (α1-AR) and Transient Receptor Potential (TRP) Triggers a Proliferative Cell Signal in Prostate Cancer Cell Lines

Calcium (Ca2+) increases the proliferation of human advanced prostate cancer (PCa) cells but the ion channels involved are unknown. Santoni and Quaglia groups investigated the correlation between alpha1D-adrenergic receptor (α1D-AR) and the transient receptor potential vanilloid type 1 (TRPV1) ion channel expression in PCa cells. The α1D-AR and TRPV1 mRNAs are increased in PCa compared to BPH. α1D-AR and TRPV1 are co-expressed in PCa cells. Norepinephrine (NE) induced α1D-AR- and TRPV1-dependent protons release, Ca2+ flux in PC3 cells and activation of PLC, PKC and ERK path-ways that stimulated PC3 cell proliferation. Similarly, a role for TRPC6 or GPR55 in α1-AR-dependent proliferation of mesangial cells and PCa cells was reported. Overall, a crosstalk between α1-AR and TRPs in PCa cells, involved in the control of cell proliferation has been demonstrated. These data strongly promote a putative novel pharmacological approach in the treatment of PCa by targeting both α1-AR and TRP channels.

Cross-talk between alpha1D-adrenoceptors and transient receptor potential vanilloid type 1 triggers prostate cancer cell proliferation.

BackgroundThere is evidence that calcium (Ca2+) increases the proliferation of human advanced prostate cancer (PCa) cells but the ion channels involved are not fully understood. Here, we investigated the correlation between alpha1D-adrenergic receptor (alpha1D-AR) and the transient receptor potential vanilloid type 1 (TRPV1) expression levels in human PCa tissues and evaluated the ability of alpha1D-AR to cross-talk with TRPV1 in PCa cell lines.MethodsThe expression of alpha1D-AR and TRPV1 was examined in human PCa tissues by quantitative RT-PCR and in PCa cell lines (DU145, PC3 and LNCaP) by cytofluorimetry. Moreover, alpha1D-AR and TRPV1 colocalization was investigated by confocal microscopy in PCa cell lines and by fluorescence microscopy in benign prostate hyperplasia (BPH) and PCa tissues. Cell proliferation was assessed by BrdU incorporation. Alpha1D-AR/TRPV1 knockdown was obtained using siRNA transfection. Signalling pathways were evaluated by measurement of extracellular acidification rate, Ca2+ flux, IP3 production, western blot and MTT assay.ResultsThe levels of the alpha1D-AR and TRPV1 mRNAs are increased in PCa compared to BPH specimens and a high correlation between alpha1D-AR and TRPV1 expression levels was found. Moreover, alpha1D-AR and TRPV1 are co-expressed in prostate cancer cell lines and specimens. Noradrenaline (NA) induced an alpha1D-AR- and TRPV1-dependent protons release and Ca2+ flux in PC3 cell lines; NA by triggering the activation of phospholipase C (PLC), protein kinase C (PKC) and extracellular signal-regulated kinase 1/2 (ERK1/2) pathways stimulated PC3 cell proliferation, that was completely inhibited by clopenphendioxan (WS433) and capsazepine (CPZ) combination or by alpha1D-AR/TRPV1 double knockdown.ConclusionsWe demonstrate a cross-talk between alpha1D-AR and TRPV1, that is involved in the control of PC3 cell proliferation. These data strongly support for a putative novel pharmacological approach in the treatment of PCa by targeting both alpha1D-AR and TRPV1 channels.Electronic supplementary materialThe online version of this article (doi:10.1186/1471-2407-14-921) contains supplementary material, which is available to authorized users.

Co-localization of L-type voltage dependent calcium channel alpha 1D subunit (Cav1.3) and calbindin (CB) in the mouse central nervous system

Previous study has shown that the co-localization of calbindin (CB) with L-type voltage dependent Ca2+ channel (VDCC) alpha 1C subunit (Cav1.2) in the rat insulinoma 1046-38 (RIN) beta cells may play an important regulatory role in Ca2+ influx and exocytosis of insulin granules. In the present study, L-type voltage dependent Ca2+ channel (VDCC) and calbindin (CB) were demonstrated in different regions of the mouse central nervous system (CNS). Double labeling immunofluorescence staining showed a co-localization of Cav1.3 and CB. The co-localization of Cav1.3 and CB in certain brain regions such as the hippocampus suggests their important roles in neuroplasticity. The relative high percentages of co-localization of Cav1.3 with CB in the laminae II of the dorsal horn of the spinal cord indicate that the regulation mechanism of nociceptive transmission may be related with both VDCC and Ca2+ binding protein.

Influence ofPanax ginsengon Alpha-Adrenergic Receptor of Benign Prostatic Hyperplasia

PurposeBenign prostatic hyperplasia (BPH) is the most common prostate problem in older men. The present study aimed to investigate the inhibitory effect of Panax ginseng C.A. Meyer (P. ginseng) on a rat model of testosterone-induced BPH.MethodsThe rats were divided into 3 groups (each group, n=10): control, testosterone-induced BPH (20 mg/kg, subcutaneous injection), and P. ginseng (200 mg/kg, orally) groups. After 4 weeks, all animals were sacrificed to examine the blood biochemical profiles, prostate volume, weight, histopathological changes, alpha-1D adrenergic receptor (Adra1d) mRNA expression, and epidermal growth factor receptor (EGFR) and B-cell CLL/lymphoma 2 (BCL2) protein expression.ResultsThe group treated with P. ginseng showed significantly lesser prostate size and weight than the testosterone-induced BPH group. In addition, P. ginseng decreased the mRNA expression of Adra1d as well as the expression of EGFR and BCL2 in prostate tissue.ConclusionsThese results suggest that P. ginseng may inhibit the alpha-1-adrenergic receptor to suppress the development of BPH.

Minireview: Potassium Channels and Aldosterone Dysregulation: Is Primary Aldosteronism a Potassium Channelopathy?

Primary aldosteronism is the most common form of secondary hypertension and has significant cardiovascular consequences. Aldosterone-producing adenomas (APAs) are responsible for half the cases of primary aldosteronism, and about half have mutations of the G protein-activated inward rectifying potassium channel Kir3.4. Under basal conditions, the adrenal zona glomerulosa cells are hyperpolarized with negative resting potentials determined by membrane permeability to K(+) mediated through various K(+) channels, including the leak K(+) channels TASK-1, TASK-3, and Twik-Related Potassium Channel 1, and G protein inward rectifying potassium channel Kir3.4. Angiotensin II decreases the activity of the leak K(+) channels and Kir3.4 channel and decreases the expression of the Kir3.4 channel, resulting in membrane depolarization, increased intracellular calcium, calcium-calmodulin pathway activation, and increased expression of cytochrome P450 aldosterone synthase (CYP11B2), the last enzyme for aldosterone production. Somatic mutations of the selectivity filter of the Kir3.4 channel in APA results in loss of selectivity for K(+) and entry of sodium, resulting in membrane depolarization, calcium mobilization, increased CYP11B2 expression, and hyperaldosteronism. Germ cell mutations cause familial hyperaldosteronism type 3, which is associated with adrenal zona glomerulosa hyperplasia, rather than adenoma. Less commonly, somatic mutations of the sodium-potassium ATPase, calcium ATPase, or the calcium channel calcium channel voltage-dependent L type alpha 1D have been found in some APAs. The regulation of aldosterone secretion is exerted to a significant degree by activation of membrane K(+) and calcium channels or pumps, so it is not surprising that the known causes of disorders of aldosterone secretion in APA have been channelopathies, which activate mechanisms that increase aldosterone synthesis.

Lack of BDNF expression through promoter IV disturbs expression of monoamine genes in the frontal cortex and hippocampus

Brain-derived neurotrophic factor (BDNF) is implicated in the pathophysiology of psychiatric conditions including major depression and schizophrenia. Mice lacking activity-driven BDNF expression through promoter IV (knock-in promoter IV: KIV) exhibit depression-like behavior, inflexible learning, and impaired response inhibition. Monoamine systems (serotonin, dopamine, and noradrenaline) are suggested to be involved in depression and schizophrenia since many of the current antidepressants and antipsychotics increase the brain levels of monoamines and/or act on monoamine receptors. To elucidate the impact of activity-driven BDNF on the monoamine systems, we examined mRNA levels for 30 monoamine-related genes, including receptors, transporters, and synthesizing enzymes, in KIV and control wild-type mice by using quantitative reverse-transcription polymerase chain reaction (qRT-PCR). mRNA levels were measured in the frontal cortex and hippocampus, which are regions related to depression and schizophrenia and where promoter IV is active. The frontal cortex of KIV mice showed reduced levels of mRNA expression for serotonin receptors 1b, 2a, and 5b (5HTR1b, 5HTR2a, 5HTR5b), dopamine D2 receptors (DRD2), and adrenergic receptors alpha 1a and 1d (AdRα1a and AdRα1b), but increased levels for serotonin synthesizing enzyme, tryptophan hydroxylase (TPH), and dopamine D4 receptor (DRD4) when compared to control wild-type mice. The hippocampus of KIV mice showed decreased levels of 5HTR5b. Our results provide causal evidence that lack of promoter IV-driven BDNF disturbs expression of monoaminergic genes in the frontal cortex and hippocampus. These disturbed expression changes in the monoamine systems may mediate the depression- and schizophrenia-like behavior of KIV mice. Our results also suggest that antidepressant and antipsychotic treatments may actually interfere with and normalize the disturbed monoamine systems caused by reduced activity-dependent BDNF, while the treatment responses to these drugs may differ in the subject with reduced BDNF levels caused by stress and lack of neuronal activity.

P.1.h.012 Changes in alpha(1D)-adrenergic receptor expression and working memory of female mice with selective glucocorticoid receptor ablation

Solanum lyratum herba (SLH) has been traditionally used for the treatment of febrifuge, diarrhea, eye disease and cancer with little scientific evidences. Thus, in the present study, to elucidate the antitumor mechanism of SLH: in vitro and in vivo experiments were performed with hexane fraction of Solanum lyratum herba (HSLH).Cytotoxicity assay, 4′-6-diamidino-2-phenylindole (DAPI) staining, flow cytometric analysis for sub-G1 peaks, Western blot analysis were used with the antibodies of apoptosis related proteins in vitro. In addition, the effect of HSLH on in vivo tumor growth was evaluated in Lewis lung carcinoma (LLC) tumor model and immunohistochemistry also was performed with terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining in tumor section.HSLH exhibited cytotoxicity against LLC cells most effectively among its solvent fractions. Ladder like DNA fragmentation and apoptotic features such as chromatin condensation and apoptotic bodies were observed in HSLH treated LLC cells by 4′-6-diamidino-2-phenylindole staining. HSLH also significantly increased sub-G1 peaks, activated caspase-8, -9 and -3 proteins and cleaved poly(ADP-ribose) polymerase (PARP). Furthermore, HSLH increased the phosphorylation of extracellular signal-regulated kinase (ERK), transiently activated phospho-JNK (c-jun N-terminal kinase) and downregulated phospho-p38 MAPK. In addition, we have found for the first time HSLH treatment effectively suppressed the in vivo growth of LLC to up to ∼30% of untreated control at 50 mg/kg and significantly increased apoptotic expression in tumor section by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining. Taken together, these findings strongly demonstrate that hexane fraction of Solanum lyratum herba exerts antitumor activity via caspase activation and MAPK regulation and can be effectively applied to lung cancer as a cancer chemopreventive agent.

30 ALPHA1D-ADRENERGIC RECEPTOR PLAYS IMPORTANT ROLES FOR COLD STRESS-INDUCED DETRUSOR OVERACTIVITY IN RATS WITH BLADDER OUTLET OBSTRUCTION

You have accessJournal of UrologyUrodynamics/Incontinence/Female Urology: Basic Research (1)1 Apr 201330 ALPHA1D-ADRENERGIC RECEPTOR PLAYS IMPORTANT ROLES FOR COLD STRESS-INDUCED DETRUSOR OVERACTIVITY IN RATS WITH BLADDER OUTLET OBSTRUCTION Takahiro Yamagishi, Osamu Ishizuka, Tetsuya Imamura, Wataru Noguchi, Hitoshi Yokoyama, Teruyuki Ogawa, Yoshiki Kurizaki, Osamu Nishizawa, and Karl-Erik Andersson Takahiro YamagishiTakahiro Yamagishi Matsumoto, Japan More articles by this author , Osamu IshizukaOsamu Ishizuka Matsumoto, Japan More articles by this author , Tetsuya ImamuraTetsuya Imamura Matsumoto, Japan More articles by this author , Wataru NoguchiWataru Noguchi Matsumoto, Japan More articles by this author , Hitoshi YokoyamaHitoshi Yokoyama Matsumoto, Japan More articles by this author , Teruyuki OgawaTeruyuki Ogawa Matsumoto, Japan More articles by this author , Yoshiki KurizakiYoshiki Kurizaki Matsumoto, Japan More articles by this author , Osamu NishizawaOsamu Nishizawa Matsumoto, Japan More articles by this author , and Karl-Erik AnderssonKarl-Erik Andersson Winston Salem, NC More articles by this author View All Author Informationhttps://doi.org/10.1016/j.juro.2013.02.1405AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookTwitterLinked InEmail INTRODUCTION AND OBJECTIVES In patients with bladder outlet obstruction, cold stress that is suddenly drop or continuously exposure to low environmental temperature exacerbates lower urinary tract symptoms such as urinary urgency and frequency. We previously reported that alpha 1 adrenoceptors play the important roles for cold stress-induced detrusor overactivity in normal rats (Neurourol Urodyn. 2008). In this study, we determined if alpha1D-adrenergic receptor antagonist, naftopidil, could improve cold stress-induced detrusor overactivity in rat with bladder outlet obstruction. METHODS Twenty-six 10-weeks female Sprague-Dawley rats were divided into two groups: naftopidil and vehicle-treated rats, and then their urethra were litigated. After 4 weeks of keeping, the rats were cannulated for cystometric investigations. Micturition patterns of the cannulated conscious rats were recorded at room temperature (RT, 27 ± 2°C) for 20 min. The rats were intravenously administered with 0.3 mg/kg naftopidil or vehicle. Five min later, they were smoothly transferred to a low temperature (LT, 4 ± 2°C), and then the micturition patterns were again recorded for 40 min. The rats that showed 2 to 5 ml bladder capacity under room temperature were estimated. RESULTS Under RT, there were no differences between vehicle-treated control and naftopidil-treated rats. After transferring to LT, voiding interval and bladder capacity of the control rats were significantly decreased. In the naftopidil-treated rats, the decreases of voiding interval and bladder capacity under LT period were significantly inhibited compared to the control rats. CONCLUSIONS This study showed that alpha1D-adrenergic receptors play important roles for detrusor overactivity exacerbated by cold stress in rats with bladder outlet obstruction. © 2013 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 189Issue 4SApril 2013Page: e12 Advertisement Copyright & Permissions© 2013 by American Urological Association Education and Research, Inc.MetricsAuthor Information Takahiro Yamagishi Matsumoto, Japan More articles by this author Osamu Ishizuka Matsumoto, Japan More articles by this author Tetsuya Imamura Matsumoto, Japan More articles by this author Wataru Noguchi Matsumoto, Japan More articles by this author Hitoshi Yokoyama Matsumoto, Japan More articles by this author Teruyuki Ogawa Matsumoto, Japan More articles by this author Yoshiki Kurizaki Matsumoto, Japan More articles by this author Osamu Nishizawa Matsumoto, Japan More articles by this author Karl-Erik Andersson Winston Salem, NC More articles by this author Expand All Advertisement Advertisement PDF downloadLoading ...

Galaxy evolution in nearby loose groups – II. Photometric and kinematic characterization of USGC U268 and USGC U376 group members in the Leo cloud★

We present the photometric and kinematic characterization of two groups, USGC U268 and USGC U376 located in different regions of the Leo cloud. U268, composed of 10 catalogued members and 11 new added members, has a small fraction (~24%) of early-type galaxies (ETGs). U376 has 16 plus 8 new added members, with ~38% of ETGs. We find the presence of significant substructures in both groups suggesting that they are likely accreting galaxies. U268 is located in a more loose environment than U376. For each member galaxy, broad band integrated and surface photometry have been obtained in far-UV and near-UV with GALEX, and in u,g, r, i, z (SDSS) bands. H_alpha imaging and 2D high resolution kinematical data have been obtained using PUMA Scanning Fabry-Perot interferometer at the 2.12 m telescope in San Pedro M\'artir, (Baja California, M\'exico). We improved the galaxy classification and we detected morphological and kinematical distortions that may be connected to either on-going and/or past interaction/accretion events or environmental induced secular evolution. U268 appears more active than U376, with a large fraction of galaxies showing interaction signatures (60% vs. 13%). The presence of bars among late-type galaxies is ~10% in U268 and ~$29% in U376. The cumulative distribution of (FUV - NUV) colours of galaxies in U268 is significantly different than that in U376 with galaxies in U268 bluer than those in U376. In the (FUV-r vs. M_r) and (NUV-r vs. M_r) planes no members of U268 are found in the `red sequence', even early-type galaxies lie in the `blue sequence' or in the `green valley'. Most (80%) of the early-type members in U376 inhabits the `red sequence, a large fraction of galaxies, of different morphological types, are located in the `green valley', while the `blue sequence' is under-populated with respect to U268.

Abstract 3640: Overexpression of five novel biomarkers in human prostate tissues and cell lines

Abstract Introduction and Objective: Our laboratory has identified several expressed sequence tags (ESTs) from primary prostate cancer (PCa) Stage T2b tissue and five were identified as Prostate and breast cancer overexpressed 1 (PBOV1), Calcium channel, voltage-dependent, l type, alpha 1d subunit (CACNA1D), Tomoregulin-1 (TMEFF1), and Copine-1 & 4 (CPNE1 & CPNE 4). PBOV1 gene is overexpressed in prostate, breast and bladder cancers and CACNA1D exists in several isoforms but little is known about their role in cancer biology. TMEFF1 is predominantly expressed in the brain and is also a cancer testes antigen. The Copines are a novel family of ubiquitous Ca2+-dependent, phospholipid-binding proteins and there is very little known about their role in cancer etiopathogenesis. We have studied their expression in cancerous and benign cancer adjacent areas of radical prostatectomy specimens as well as their protein levels in PCa, BPH and normal prostate cell lines. Methods: Nineteen sets of RNA samples, extracted from PCa tissues and respective benign adjacent areas were received from Dr. DeMarzo. From 50ng of RNA, cDNA was generated and the real-time PCR for expression was done using SsoFast EvaGreen supermix kit in an iCycler instrument (BioRad Laboratories) utilizing the gene specific primers. For calculating relative expression, a portion of β-actin was also amplified using a validated primer set (OriGene). Alongside cell lines of PCa (PC3, DU145 & LNCaP); of Benign prostatic hyperplasia (BPH) and of normal prostate (PrEC) were grown in cultures and total protein was extracted from each. Using specific antibodies, the presence of these proteins were identified by Western blotting. Results: When compared to the corresponding benign adjacent areas, the expression increased significantly in cancer tissues of: 12 samples for PBOV1, 14 samples for CACNA1D, 7 samples for TMEFF1, 9 samples for CPNE1 and 13 samples for CPNE4. Also, preliminary proteomic data by Western blotting in cell line extracts also demonstrates differential expression in PCa and control cell lines: PBOV1 was expressed in PC3, DU145 & BPH; TMEFF1 in PC3 & DU145 (not tested in BPH & PrEC); CACNA1D in PC3, DU145 & LNCaP; CPNE1 in BPH & PrEC and CPNE4 in none of the cell lines. Conclusions: The increased expression of these novel biomarkers in cancer areas vs. the benign cancer-adjacent may be very useful in establishing significant ratios and cut-off values to determine their potential clinical applications. Currently we continue correlating these altered expressions with Gleason grades, stages and other outcomes using a larger sample size. We also continue to study the role of these biomarkers in the pathogenesis of more aggressive prostate cancer phenotypes. Source of Funding: NIH U54CA143803 grant, Prostate Cancer Foundation and the Patana Fund Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 3640. doi:1538-7445.AM2012-3640

Impact of calcium channel antagonists for estrogen action on the endometrial carcinoma HEC-1A cells

To study the effects of nifedipine and mibefradil on the cell proliferation, apoptosis, migration on the HEC-1A in vitro and also study the mRNA and protein expression levels of the calcium channel alpha1D (Cav1.3) and calcium channel alpha1G (Cav3.1) to discuss the effects of the calcium antagonists on the mechanisms of the endometrial carcinoma. (1) Add 10 µmol/L nifedipine and mibefradil at 15 minutes before adding 10 µmol/L 17β-estradiol (17β-E(2)) and 100 µmol/L b-estradiol-6-(O-carboxymethyl)oxime (E(2)-BSA) to the HEC-1A in different time including 0, 5, 15, 30, 60, 120 minutes. Then the changes of mRNA and protein were detected by reverse transcripiton (RT)-PCR and western-blot. (2) Add 1.25, 2.5, 5, 10, 20, 40, 80, 100 µmol/L nifedipine and mibefradil to the HEC-1A at 24, 48, 96 hours to detect the cell proliferation by 3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di-phenytetrazoliumromide (MTT) method. (3) Add 10 µmol/L nifedipine and mibefradil to the HEC-1A, then detect the apoptosis at 0 minute, 30 minutes, 1 hour, 6 hours, 24 hours and migration in vitro at 36 hours with transwell methods. (1) After the pretreated effect of the nifedipine before 17β-E(2), the mRNA express of Cav1.3 genes was lowest at 15 minutes, and returned to the control level after 30 minutes. The protein level didn't change very much in 30 minutes, but rose after 60 minutes. The Cav3.1 genes mRNA express was lowest at 5 minutes, rose at 30 minutes and returned to the 0 minute level gradually. (2) After the pretreated effect of the nifedipine before E(2)-BSA, the Cav1.3 genes mRNA was lowest at 5 minutes and returned at 15 minutes. The protein level rose gradually in 15 minutes but reduced after 15 minutes. The Cav3.1 mRNA and protein level were reduced at every time point. (3) After the pretreated effect of the mibefradil before 17β-E(2), there was no change of mRNA expression of Cav1.3 genes. The protein level rose at 15 and 60 minutes, there was no change in any other time. The Cav3.1 genes mRNA were gradually reduced and the protein level rose at 15 minutes, and there was no change in any other times. (4) After the pretreated effect of the mibefradil before E(2)-BSA, the mRNA and protein of Cav1.3 levels were reduced after 15 minutes. There was no mRNA expression of Cav3.1, while the protein level was lowest at 15 minutes. (5) Nifedipine and mibefradil affected HEC-1A proliferation depended on the different concentration and interval time points. There was significant difference than those in control group (P < 0.05). (6) There were statistical differences in apoptosis rate after adding nifedipine (P < 0.05), while rose at mibefradil treated the same time (24 hours: 8.41 ± 0.07, 0 minute: 3.74 ± 0.18; P < 0.05). (7) The numbers of stained cells after both nifedipine and mibefradil treated reduced more than control group. (1) Nifedipine and mibefradil could inhibit both the effect of the estrogen on the L-type and T-type calcium channel in short time, meanwhile the mibefradil effects last long time. (2) The inhibited effect of the mibefradil on the proliferation, apoptosis and migration of HEC-1A cells in vitro is more significant than that by nifedidipine.

The efficacy and safety of oral Tamsulosin controlled absorption system (OCAS) for the treatment of lower urinary tract symptoms due to bladder outlet obstruction associated with benign prostatic hyperplasia: an open-label preliminary study

Tamsulosin, a superselective subtype alpha 1a and 1d blocker, is used for the treatment of male lower urinary tract symptoms (LUTS) commonly caused by benign prostatic hyperplasia (BPH). This prospective study evaluated the efficacy and safety of a new formulation, Tamsulosin OCAS® (Oral Controlled Absorption System), for LUTS associated with BPH in Thai patients. Fifty one patients over 40 years old with complaints of LUTS associated with BPH were recruited. Patients received an 8 week course of once daily 0.4 mg tamsulosin OCAS®, and were followed up at 2 (visit 3), 4 (visit 4) and 8 (visit 5) weeks post-treatment. At each visit, patients were assessed using the International Prostate Symptom Score (IPSS), Nocturia Quality of Life (N-QoL) Questionnaire, QoL Assessment Index (IPSS-QoL), and International Index of Erectile Function (IIEF). The primary outcome was efficacy of Tamsulosin. The secondary outcomes included change in the mean number of nocturia episodes, hours of undisturbed sleep (HUS) and uroflowmetry measurements. Total IPSS significantly decreased at week 8 from baseline (from 19.52 to 6.08; p < 0.001). Similarly, the voiding and storage subscores of IPSS also continued to improve significantly starting from the second and third visits, respectively (p < 0.001 versus baseline). The IPSS-QoL and N-QoL scores significantly improved at visit 3 through end of study. In addition, we observed significant nocturia and HUS improvement in their last clinic visit. Uroflowmetry parameters, Qmax and Qave, improved significantly at 3rd clinic visit. Three patients experienced mild dizziness. Tamsulosin OCAS® treatment led to significant improvements in LUTS, HUS and QoL in Thai patients with bladder outlet obstruction from BPH with few side effects.

Alpha-1 Adrenergic Receptor Signaling Linked to Memory Dysfunction Following Brain Trauma

Alpha-1 Adrenergic Receptor Signaling Linked to Memory Dysfunction Following Brain Trauma

2297 NOVEL BIOMARKERS FOR AGGRESSIVE PROSTATE CANCER

You have accessJournal of UrologyProstate Cancer: Markers1 Apr 20112297 NOVEL BIOMARKERS FOR AGGRESSIVE PROSTATE CANCER Christhunesa Christudass, Andrew Lelin, Alan Partin, Jun Luo, and Robert Veltri Christhunesa ChristudassChristhunesa Christudass Baltimore, MD More articles by this author , Andrew LelinAndrew Lelin Baltimore, MD More articles by this author , Alan PartinAlan Partin Baltimore, MD More articles by this author , Jun LuoJun Luo Baltimore, MD More articles by this author , and Robert VeltriRobert Veltri Baltimore, MD More articles by this author View All Author Informationhttps://doi.org/10.1016/j.juro.2011.02.2542AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookTwitterLinked InEmail INTRODUCTION AND OBJECTIVES A gene discovery project identified several differentially expressed sequenced tags (ESTs) by Arbitrarily-primed Differential Analysis (ADA) of RNA from primary prostate cancer (PCa) Stage T2b prostatectomy tissue. Three ESTs were identified from the human genome sequence: UC-31 (673bp) or TMEFF1(Tomoregulin-1); UC38 (166bp) or Calcium channel, voltage-dependent, l type, alpha 1d subunit (CACNA1D); and UC-28 (600bp) or Prostate Overexpressed Breast and Prostate-1 (PBOV-1)genes. These three genes were confirmed as being overexpressed in PCa using relative quantitative RT-PCR normalized using the β-actin gene. We confirmed differential expression and extended our findings using real time qRT-PCR. We are developing a ‘molecular biomarker panel' that when the biomarkers are differentially expressed in PCa prognostic accuracy will improve. METHODS Benign and tumor RNA samples were received from Dr. Jun Lou and cDNA was generated with 50ng of RNA using iScript cDNA synthesis kit (Bio Rad Laboratories) in a PTC-100 thermal cycler. following the manufacturer's protocol. The real-time PCR was done using the gene specific primers in a iCycler instrument (Bio Rad Laboratories) using SsoFast EvaGreen supermix kit following the manufacturer's protocol. The primers used for PBOV1 are: GCTCTTACCATTCTGCTACAAGG (forward) and CATGGTCAAGTGTGTCTGCAAGG (reverse). The primers used for TMEFF1 are: AACACTCCAAGTGTGGACCCTG (forward) and GGAACTCCCATCAGAAGCACAC (reverse). For calculating relative expression, a portion of β-actin was also amplified using a validated primer set from OriGene (Rockville, MD). The results were normalized by keeping the lowest normal value as one and graphs were then plotted. RESULTS The pre-qualifying data were developed using real time qRT-PCR, demonstrated significant overexpression of TMEFF1, CANCNA1D, and PBOV-1 genes in radical prostatectomy specimens from Johns Hopkins Hospital. In a set of five normal (benign area of cancer gland) and 18 PCa tumors of various Gleason Grades, the increased expression of the three gene panel in combination, enhanced the prognostic accuracy of identifying aggressive PCa. The Figure illustrates the concept for 2/3 biomarkers, where TMEFF1 and PBOV-1 are differentially regulated in the test samples. CONCLUSIONS A set of three cancer-associated genes over-expressed in PCa when combined provide prognostic evidence of an aggressive phenotype. Next, we will use quantitative IHC (qIHC) with antibodies to confirm our results in a progression PCa tissue microarray (TMA). © 2011 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 185Issue 4SApril 2011Page: e921 Advertisement Copyright & Permissions© 2011 by American Urological Association Education and Research, Inc.MetricsAuthor Information Christhunesa Christudass Baltimore, MD More articles by this author Andrew Lelin Baltimore, MD More articles by this author Alan Partin Baltimore, MD More articles by this author Jun Luo Baltimore, MD More articles by this author Robert Veltri Baltimore, MD More articles by this author Expand All Advertisement Advertisement PDF downloadLoading ...

Vesicoureteral Reflux and Primary Bladder Neck Dysfunction in Children: Urodynamic Evaluation and Randomized, Double-Blind, Clinical Trial on Effect of α-Blocker Therapy

Primary bladder neck dysfunction has been under diagnosed as a treatable cause of vesicoureteral reflux. We evaluated the effect of prazosin administration on vesicoureteral reflux resolution and urodynamic parameters in children with idiopathic primary reflux and primary bladder neck dysfunction. A total of 62 children (mean ± SD age 7.9 ± 2.4 years) with documented vesicoureteral reflux and urodynamics proved primary bladder neck dysfunction were randomized to receive either 0.025 mg/kg α-blocker (prazosin, 40 patients) or placebo (22) nightly for 1 week with a subsequent increase to 2 divided doses. Patients were followed for 12 months with clinical evaluation and uroflowmetry performed every 2 months, and each patient underwent complete urodynamic study at 6-month intervals. In the placebo group no uroflowmetry or urodynamic parameter changed significantly at 1-year followup. A 60% decrease in reflux grade was observed in the treatment group compared to 17% in the placebo group. Mean maximal detrusor pressure, post-void residual and opening time were significantly decreased in both followup sessions in the prazosin group (p <0.05). Average flow rate improved from 4.30 to 12.80 ml per second at 6 months and to 13.10 ml per second at 12 months (both p <0.05). Special attention should be given to secondary causes of vesicoureteral reflux (such as primary bladder neck dysfunction, an underdiagnosed entity in children), since conventional treatment will most likely fail if these conditions are not addressed promptly. In this study prazosin was effective therapy for children with vesicoureteral reflux and primary bladder neck dysfunction.

Modeling the Interactions Between &amp;#945;1-Adrenergic Receptors and Their Antagonists

As crucial members of the G-protein coupled receptor (GPCR) superfamily, alpha (1)-adrenergic receptors (alpha(1)-ARs) are recognized to intervene the actions of endogenous catecholamines such as norepinephrine and epinephrine. So far three distinct alpha(1)-AR subtypes, alpha(1A), alpha(1B) and alpha(1D), have been characterized by functional analysis, radio-ligand binding and molecular biology studies. The alpha(1)-ARs are of therapeutic interest because of their distinct and critical roles in many physiological processes, containing hypertension, benign prostatic hyperplasia, smooth muscle contraction, myocardial inotropy and chronotropy, and hepatic glucose metabolism. Accordingly, designing subtype-selective antagonists for each of the three alpha(1)-AR subtypes has been an enthusiastic region of medicinal research. Even though a large number of studies on GPCRs have been conducted, understanding of how known antagonists bind to alpha(1)-ARs still remains sketchy and has been a serious impediment to search for potent and subtype-selective alpha(1)-AR antagonists because of the lack of detailed experimental structural knowledge. This review deliberates the simulation of alpha(1)-ARs and their interactions with antagonists by using ligand-based (pharmacophore identification and QSAR modeling) and structure-based (comparative modeling and molecular docking) approaches. Combined with experimental data, these computational attempts could improve our understanding of the structural basis of antagonist binding and the molecular basis of receptor activation, thus offering a more reasonable approach in the design of drugs targeting alpha(1)-ARs.

Is a blood pressure rise the only deleterious off-target effect of cholesterol ester transfer protein inhibitors?

Is a blood pressure rise the only deleterious off-target effect of cholesterol ester transfer protein inhibitors?

Angiotensin‐II type 1 receptor (AT1R) and alpha‐1D adrenoceptor form a heterodimer during pregnancy‐induced hypertension

Pregnancy courses with low response to angiotensin II and adrenergic agonists. In preeclampsia, both effects are reverted. It is known that angiotensin II regulates adrenergic system. It is not known, however, the interaction between both systems receptors. Our aim was to study if AT(1)R and alpha1D adrenoceptor heterodimerize in preeclampsia. We used subrenal aorctic coarctation in pregnant rats. Aortic tissues were prepared for confocal imaging and coimmunoprecipitated for alpha1D and AT(1) receptors. We found that AT(1)R and alpha1D adrenoceptor heterodimerize in both, healthy and preeclamptic groups. In healthy pregnant rats, heterodimer is barely detected. In preeclamptic rats however, we found higher heterodimerization. These results suggest that AT(1)R and alpha1D -adrenoceptor may form heterodimers, and may play a role in preeclampsia.

Investigation of the distribution and function of α‐adrenoceptors in the sheep isolated internal anal sphincter

We have investigated the distribution of alpha-adrenoceptors in sheep internal anal sphincter (IAS), as a model for the human tissue, and evaluated various imidazoline derivatives for potential treatment of faecal incontinence. Saturation and competition binding with (3)H-prazosin and (3)H-RX821002 were used to confirm the presence and density of alpha-adrenoceptors in sheep IAS, and the affinity of imidazoline compounds at these receptors. A combination of in vitro receptor autoradiography and immunohistochemistry was used to investigate the regional distribution of binding sites. Contractile activity of imidazoline-based compounds on sheep IAS was assessed by isometric tension recording. Saturation binding confirmed the presence of both alpha(1)- and alpha(2)-adrenoceptors, and subsequent characterization with sub-type-selective agents, identified them as alpha(1A)- and alpha(2D)-adrenoceptor sub-types. Autoradiographic studies with (3)H-prazosin showed a positive association of alpha(1)-adrenoceptors with immunohistochemically identified smooth muscle fibres. Anti-alpha(1)-adrenoceptor immunohistochemistry revealed similar distributions of the receptor in sheep and human IAS. The imidazoline compounds caused concentration-dependent contractions of the anal sphincter, but the maximum responses were less than those elicited by l-erythro-methoxamine, a standard non-imidazoline alpha(1)-adrenoceptor agonist. Prazosin (selective alpha(1)-adrenoceptor antagonist) significantly reduced the magnitude of contraction to l-erythro-methoxamine at the highest concentration used. Both prazosin and RX811059 (a selective alpha(2)-adrenoceptor antagonist) reduced the potency (pEC(50)) of clonidine. This study shows that both alpha(1)- and alpha(2)-adrenoceptors are expressed in the sheep IAS, and contribute (perhaps synergistically) to contractions elicited by various imidazoline derivatives. These agents may prove useful in the treatment of faecal incontinence.