Agricultural University Peshawar Research Articles

Performance of Test Crosses of Maize Variety Sarhad White with Jalal and Kiramat for Morphological Traits

This research was carried out at Khyber Pakhtunkhwa Agricultural University Peshawar to evaluate the performance of maize inbred lines derived from maize variety Sarhad White regarding grain yield and morphological traits and identifying superior inbred lines based on test cross performance. Test crosses were evaluated in replicated trial along with two tester, one check and 16 parental inbred lines for comparison in a 7×7 partially balanced lattice square design with two replications. Results revealed highly significant differences among the genotypes for most of the traits. Jalal TC-230-a and TC-63-1 took the maximum days to tasseling and Jalal TC-101-2 showed maximum days to anthesis. Maximum day to silking and anthesis silking interval were recorded in Jalal TC-94. Maximum plant height was observed in Jalal TC-33 (164.5 cm) and Kiramat TC-9-6-1 (141.50 cm). Maximum 100 kernal weight was recorded in Jalal TC-101-2 (40.55 g). Kiramat TC-89-b produced the highest grain yield (6808 kg ha-1). From these results, it can be concluded that Kiramat TC-89-b, having highest yield, could be promoted for further selfing. Jalal TC-9-6, TC-9-6-1, TC-12-1, TC-63-1, TC-76-2b, TC-89b, TC-163, TC-205, TC-230a, TC-211 and Kiramat TC-9-6, TC-9-6-1, TC-12-1, TC-33, TC-76-2b, TC-89b, TC-94, TC-101-2, 150-c, TC-163, TC-230-a, 205, 211, 226-2 in addition to having satisfactory grain yield could be used for selfing. Among parental lines (selfed lines) 9-6-1, 9-6, 10-2, 226-2, 33, 63-1, 76-2, 163, 89-b, 205 and 211 were promising for grain yield and morphological traits.

Effect of mode of Zinc application on yield and yield components of Maize

There are three main methods of adding micronutrients to crops: soil fertilization, foliar spray and seed treatment. Each method has the potential to affect plant micronutrient nutrition. The objective of this research was to evaluate different methods of Zn application in maize. For this purpose, a field experiment was conducted at Agricultural Research Farm of NWFP Agricultural University Peshawar during summer 2006. The experiment was laid out in Randomized Complete Block design with three replications. Three methods of Zn application, soil application, foliar spray and seed treatment were included in the experiment. Three doses of Zinc sulphate (5, 10 and 15 kg ha-1) were supplied to the maize crop as soil application before sowing. Solutions of 0% (water), 0.1%, 0.2% and 0.3% Zinc sulphate were sprayed on the crop at 5-6 leaf stage. For seed priming, the maize seed was soaked in 0% (water), 0.1%, 0.5% and 1% Zinc sulphate solutions for 16 h. The control treatment was dry seeds of maize. Soil application of Zinc sulphate at the rate of 15 kg ha-1 resulted in higher grains cob-1, thousand grain weight and grain yield of maize. Planned mean comparison indicated that soil application of Zn was a superior fertilization method as compared to foliar or seed priming. It is concluded that soil application of Zinc sulphate at the rate of 15 kg ha-1 enhances yield and yield components of maize.

Impact of workers’ Remittances on Households’ Standard of Living: A Case Study of District Kech Balochistan

Migration of Workers is a common phenomenon in underdeveloped regions. Lack of jobs opportunities and poverty in home country compel workers to migrate to developed countries.  The objective of this research is to study the impact of remittances on standard of living of recipients’ households in district Kech (Balochistan), Pakistan. workers’ remittances are essential in developing standard of living.  For this purpose, survey-based data of 200 respondents is used to construct the standard of living index by Principal Component Analysis (PCA). The result supports the hypothesis that workers’ remittances have affected standard of living of the recipients’ families positively and significantly. Also providing training and make them learn skills which are necessary components for migrant workers to earn handsome salaries and incomes in overseas so that their finincial contribution enable the recipents’ family to live properious life. References Abbas, , Sabir, H. M., Shehzadi, A., & Abbas, Q. (2014). Impact of workers’ remittances on household welfare in district Jhang (a case study of Tehsil 18 Hazari). Journal of Finance and Economics, 2(4), 131-135. Ahmad, , Ahmad, A., & Hayat, M. F. (2013). Foreign remittances and economic growth in Pakistan: An empirical investigation. Journal of Basic and Applied Scientific Research, 3(7)813-819, 2013. Ajaero, C. K., Nzeadibe, C. T., Obisie-Nmehielle, N., & Ike, C. C. (2018). The linkages between international migration, remittances and household welfare in Nigeria. Migration and Development, 7(1), 40-54. Akhter, N., & Islam, M. (2019). The Impact of Migration and Migrant Remittances on Household Poverty in Bangladesh. Journal of Poverty Alleviation & International Development, 10(1), 43-59. Chiswick, B., & Hatton, T. J. (2003). International migration and the integration of labor markets. In Globalization in historical perspective. 65-120. University of Chicago Chowdhury, I. A. (2014). Impacts of remittance on the socio-economic condition of Bangladesh: An analysis. Innovative Issues and Approaches in Social Science, 7(3), 23-43. Cuong, N. V., & Linh, V. H. (2018). The impact of migration and remittances on household welfare: Evidence from Vietnam. Journal of International Migration and Integration, 19(4), 945-963. Deaton, A., & Paxson, C. (1998). Economies of scale, household size, and the demand for food. Journal of political economy, 106(5), 897-930. Dhungana, A. R., & Pandit, D. (2014). Socio-economic impact of remittance on households in Lekhnath Municipality, Kaski, Nepal. Economic Literature, 12(7), 39- 49. Eversole, R., & Johnson, M. (2014). Migrant remittances and household development: an anthropological analysis. Development Studies Research. An Open Access Journal, 1(1), 1-15. Government of Balochistan. (2018-19). Finance department of Balochistan. https:// balochistan.gov.pk Government of Pakistan. (2021-22). Economic survey of Pakistan. http://www.finance. gov.pk/survey_1213.html Grace, B. Y., Lee, D. J., Sirgy, M. J., & Bosnjak, M. (2019). Household Income, Satisfaction with Standard of Living, and Subjective Well-Being. The Moderating Role of Happiness Materialism. Journal of Happiness Studies, 1-22. Gunnsteinsson,, Labrique, A. B., West Jr, K. P., Christian, P., Mehra, S., Shamim, A. A., ... & Klemm, R. D. (2010). Constructing indices of rural living standards in Northwestern Bangladesh. Journal of health, population, and nutrition, 28(5), 509. Howe, L. D., Hargreaves, J. R., Ploubidis, G. B., De Stavola, B. L., & Huttly, S. R. (2011). Subjective measures of socio-economic position and the wealth index: a comparative analysis. Health policy and planning, 26(3), 223-232. Javaid, (2017). Impact of remittances on consumption and investment (Case Study of Tehsil Sargodha, Punjab, Pakistan). Journal of Finance and Economics, (5)4, 156-163. Khan, M. (2010). Socio-economic impact of overseas workers remittances on the recipient households in district Swabi, Pakistan (Doctoral dissertation, NWFP Agricultural University Peshawar, Pakistan).http://prr.hec.gov.pk/jspui/handle/ 123456789//290 (Online). Khan, , Rahim, T., Shah, M. K., Alam, A., Naeem, M., & Zeb, J. (2008). An assessment of the volume of workers remittances and their socio-economic impact in recipient regions of North-West Frontier Province, Pakistan (A Case Study of Dir District). Sarhad Journal of Agriculture (Pakistan). 24(3), 513-520. Niaz, , Mushtaq, A., Nisar, A., Musawar, S., Intikhab, A., & Muhammad, J. (2010). The impact of foreign remittances on the socio-economic conditions of households (a case study of rural areas in Dir Lower, NWFP). Sarhad Journal of Agriculture, 26(1), 141-145. Pakistan Bureau of Statistic, (2017) Government of Pakistan. Http://www.pbs.gov. pk/content/pakistan-statistical-year-book-2017. Peković, D. (2017). The effects of remittances on poverty alleviation in transition countries. Journal of International Studies, 10(4), 37-46. Tsaurai, K. (2018). The impact of remittances on poverty alleviation in selected emerging markets. Comparative Economic Research, 21(2), 51-68. Vyas, S., & Kumaranayake, L. (2006). Constructing socio-economic status indices: how to use principal components analysis. Health policy and planning, 21(6), 459-468. Wadood, N., & Hossain, A. (2017). Microeconomic impact of remittances on household welfare: Evidences from Bangladesh. Business and Economic Horizons (BEH), 13(1), 10-29. Wagstaff, A., & Watanabe, N. (2003). What difference does the choice of SES make in health inequality measurement? Health economics, 12(10), 885-890.

MICROBIOLOGICAL QUALITY ASSESSMENT OF RAW COWS MILK IN PESHAWAR DISTRICT


 Objectives
 To study the microbial analysis of raw cow's milk collected from selling points of Peshawar.
 Materials and methods: A total of 80 aseptically raw milk samples were collected by multistage sampling technique from four towns of Peshawar in sterile glass bottles and stored in ice container for laboratory analysis at Agriculture University Peshawar. Microbial analysis was performed on plate count and samples were screened for staph aureus, E.coli spp, and salmonella spp. Microbiological load was tested and the data were analyzed by Statistical Package for Social Sciences (SPSS) version 20.
 Results: The microbial analysis of milk revealed contamination of milk and most prevalent bacteria was Escherichia coli (26.2%) and least prevalent was Salmonella spp (3.75%).
 Conclusion Although the presence of E.coli spp, staph spp and salmonella spp. indicate that the milk is contaminated but found that total bacterial count was within permissible limit. If not controlled in time will lead to public health issues. This highlights an urgent need to adopt good sanitary practices and monitoring of milk from production to distribution by the health authorities.

First Report of Tomato leaf curl New Delhi virus in Physalis minima in Pakistan

Tomato leaf curl New Delhi virus (ToLCNDV), a bipartite begomovirus, is an emerging problem for agricultural crops in Pakistan (Zaidi et al. 2016). In 2017, severe symptoms and high incidence of yellow mosaic and leaf curl disease attributable to infection by ToLCNDV (Sohrab et al. 2003) was observed in luffa (Luffa acutangula) grown in the Malakand region (Khyber Pakhtunkhwa province). Several plants of Physalis minima, a common weed plant in and around luffa fields, also exhibited severe mottling and leaf curling symptoms. Leaves from three symptomatic plants of luffa and P. minima tested positive for ToLCNDV using polyclonal antibodies (DSMZ, Germany) in double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). To further confirm the identity of the virus, DNA was extracted from all the collected leaf samples using a CTAB-based DNA extraction method (Doyle and Doyle 1990). Polymerase chain reaction (PCR) was conducted using ToLCNDV-specific primers ToLCNDV-up (GAACTATGG TGAAGCGACCAGCAGA) and ToLCNDV-do (ACACAGGTCCTTAGGTACCTGG) as described by Alfaro-Fernandez et al. (2016). One ToLCNDV-positive control (accession no. EF620534 obtained from NWFP Agriculture University Peshawar, Pakistan) was also included in PCR, and a healthy plant was used as a negative control. A single amplicon of expected size (∼914 bp) was amplified by PCR from all the ELISA-positive samples of luffa and P. minima including the positive control, whereas no amplicon was amplified from healthy samples. One amplicon each from luffa and P. minima was sequenced in both directions, and the consensus sequences were deposited in GenBank under accession numbers MK560176 and MK560177, respectively. BLASTn analyses of the sequence from luffa (MK560176) and P. minima (MK560177) showed the highest identity (99%) with a ToLCNDV isolate (AF448058) reported on tomato in Malakand region (Shih et al. 2003). Infection of luffa by ToLCNDV was recently reported in Pakistan (Anwar et al. 2020). This is the first report of this virus naturally infecting P. minima. Based on our findings, further targeted surveys must be undertaken to advance our knowledge on alternative hosts of this virus in the region.

The Cap, Socks and Bunyan Wearing Role in the Control of Influenza Disease in Winter Season in Agriculture University Peshawar-Pakistan

The Study was carried out in the Agriculture University Peshawar in December 2019. The study objective was that to examine the Cap, Socks and Bunyan role in the control of Influenza diseases in winter season in the study area. The total population absolutely of the agriculture University Peshawar employees and student was 14000 while the portion of the employees was 1000 and student was 13000. The sample was fixed according to Yamani formula 389 and through allocation proportion methodology the sample was distributed into two categories. The employee’ number was 28 while the students’ number was 361. Through questionnaire data was collected from the respondents according to study objectives. Majority respondents told that cap, socks and Bunyan play great role in the control of Influenza disease in the winter season. They also told that due to poverty the poor people cannot purchased the mentioned Cap, Socks and Bunyan in the winter season, so the poor people were highly affected by this disease. Majority poor people purchase the said items in the Caber and used in the winter season and which also bring other diseases to the country from foreign. So, on the basis of problems the study recommends that to arrange different programs for poverty alleviation in the country for pushing their purchasing power because income increasing play great role in controlling Influenza. It is also observed in daily life that majority people do not wear the mentioned items in the winter season, so they mostly affected by this disease in the study area, so in winter season the mentioned items wearing is required for safety of these diseases controlling.

ANTIMICROBIAL ACTIVITY OF THUJA ORIENTALIS IN COMBINATION WITH CIPROFLOXACIN AGAINST PSEUDOMONAS AERUGINOSA

OBJECTIVES: To compare the combined antimicrobial effect of Thuja orientalis and Ciprofloxacin against Pseudomonas aeruginosa in vitro samples. METHODS: In-vitro antibacterial activity of plant-extracts was evaluated alone and in combination with ciprofloxacin against Pseudomonas aeruginosa using disc-diffusion susceptibility assay (Kirby Bauer method) and minimum inhibitory concentration (96 well broth microdilution method) following CLSI guidelines. Pseudomonas aeruginosa clinical strains were collected from Rehman Medical Institute (RMI) and Northwest General Hospital Peshawar, Pakistan and ATCC strains (no.9721) of this bacterium were collected from Agriculture University Peshawar. The organism was tested six times with crude extract and fractionation with different solvents such as n-hexane, chloroform, ethyl acetate and butanol at concentrations of 1, 4, 8, 12, 16, 20, 24, 30 and 36 mg/ml. The mean MIC and FICI (fractional inhibitory concentration index) was obtained to report the synergism. The data were analysed using SPSS version-21. RESULTS: In combination, methanolic crude extract, chloroform and butanol fraction showed synergistic effect at all tested concentrations against Pseudomonas aeruginosa (ATCC 9721 and clinical) except with 1, 4, 16 mg/ml concentrations. Ethyl acetate and aqueous fractions shows indifference and synergistic effect against Pseudomonas aeruginosa (ATCC 9721 and clinical) at different concentrations. The fractional inhibitory concentration index (FICI) ranged from 1.24 to 3.24 against Pseudomonas aeruginosa alone and in combination with ciprofloxacin. CONCLUSION: By disc diffusion method, this study shows synergistic effect against Pseudomonas aeruginosa in combination with ciprofloxacin. However, through minimum inhibitory concentration method, it shows antagonism and indifference but no synergistic effect against different fractions of plant.

Generation mean analysis for grain yield and its components in popcorn

Abstract Knowledge about genetic composition of a character helps plant breeders to plan their breeding programs. Grain yield and related traits are very important in maize breeding programs. In our experiment four each of parents, F1s, F2s, BC1s and BC2s were evaluated at Cereal Crops Research Institute (CCRI), Pirsabak, Nowshehra and Agriculture University Peshawar. The experimental material at both locations were replicated thrice in randomized complete block design. In all crosses dominance gene action was found to be important in the inheritance of ear diameter, ear length, percent shelling and grain yield. Additive genetic effects were found negative and non-significant in all four crosses for percent shelling. Duplicate type of non-allelic interactions was observed for shelling percentage in all crosses. Duplicate type of epistasis was observed in cross, PS-1 × BD-1 and PS-2 × BD-1 for ear length. For grain yield both complementary and duplicate type of epistasis were observed. Additive genetic effects werefound significant with positive and negative magnitude in two crosses each. It is concluded that crosses, where dominant gene action was found predominant, should be effectively utilized in hybrid maize programs for improved grain yield and related traits.

Application of Different Organic Acids on Phosphorus Solubility from Rock Phosphate

An incubation experiment was conducted on P solubilization from rock phosphate (RP) through different organic acids such as oxalic acid, citric acid, acetic acid, humic acid and sulphur in the laboratory of the Department of Soil and Environmental Sciences, KP Agricultural University Peshawar during fall 2011. The experiment was laid in a complete randomize design. There were three replications with six treatments. The organic acids were used at the rate of 2 % for 50 g RP in 250 ml conical flasks. These samples were kept in an incubator at 250c for four months and analysed for Mehlic-3 extractable P and pH values after 20 days interval. Statiscal analyses were made and maximum P concentration of 1.52% was observed in the treatment of oxalic acid mixed with RP followed by the treatments of RP mixed with humic acid with P concentration of 0.368% (Fig. 1). Rapid increases in P solubility from RP by mixing with oxalic acids were noted up to 60thdays of incubation period and then remained stable after this period. Solubilization of P from RP by mixing with other organic acids was inconsistent. The pH in treatment of citric acid mixed with RP was noted as 5.64, followed by the treatments of oxalic acid with pH values of 6.31. A dramatic increase in pH value of 9.33 was observed in the treatment of RP mixed with humic acid. It is because the humic acid contains sodium salt and sodium hummate causes increase in its pH values.

Sulphate of potash and dipping time influence the seed germination and growth of pecan nuts

To investigate the influence of various levels of SOP and dipping time on seed germination and growth of pecan nuts, a study was carried out at Horticulture Department, Agriculture University Peshawar, Pakistan (during 2012). The experiment consists of SOP levels (0,2,4,6,8 & 10%) and dipping times (5,10,15 & 20 hours) respectively in order to find out the optimum level of SOP and best dipping time for successful germination and better growth of pecan nuts. The results revealed that SOP levels and dipping time significantly affected most of the parameters under study. The interactions between SOP and dipping time showed significant differences for all parameters except germination percentage, root length, leaf area plant-1, stem diameter. The pecan nuts treated with 10% SOP solution showed best result regarding, number of roots plant-1(73.00), seedling height plant-1 (22.53 cm), stem diameter plant-1 (0.63 cm), root length (61.67 cm), germination percentage (70.83%). The mean data for dipping time indicated that the pecan nuts dipped for 10 hours showed best results for number of roots plant-1(69.00), seedling height plant-1 (19.04 cm), root length plant-1 (56.11 cm), germination percentage (65.00 %), and. It was concluded from the experiment that SOP @ 10% with 10 hours of dipping time gave best results in seed germination, seedling growth and establishment of pecan nuts plants under agro climatic conditions of Peshawar, Pakistan. Keywords: Dipping times; Sulphate of potash; Pecan nuts; Germination http://dx.doi.org/10.19045/bspab.2017.60029

Germination and field emergence potential of soybean land races vs improved varieties under different sowing dates

Poor seed quality resulting in the establishment of poor stand which is the major problem of production in the cultivation of soybean. The objectives behind study were to evaluate the standard germination, field emergence and field emergence index of the seeds obtained from three land races (Kulat brown, Kulat white, Mothi) and two improved varieties (NARC-II, Swat-84) of soybean sown at four different dates at monthly interval from April to July during 2004, 2005 at New Developmental Farm, Agriculture University Peshawar. Standard germination, field emergence and field emergence index were significantly affected by sowing dates and varieties. In addition, to field emergence and field emergence index were observed to be affected by years. Sowing dates x varieties interactions were found significant for field emergence only. Maximum germination (74.6 %), field emergence (60.2 %) and field emergence index (79.1) were recorded for seeds harvested from May, April and April planted crops respectively. Kulat brown exhibited maximum germination (79 %), field emergence (66.1 %) and emergence index (83.6). In land races, germination, field emergence and field emergence index were detected as higher by 39, 58 and 12 percent comparatively to improved varieties. It is concluded that land races have the potential to emerge in various environmental conditions contrasted with improved varieties of soybean. Keywords: Germination; Field emergence; Field emergence index; Soybean land races http://dx.doi.org/10.19045/bspab.2017.60007

Problem of Learning Contents through English at BS Level: A Case Study of Agriculture University Peshawar

The present research relates English language teaching (ELT) effects on learning contents at the BS level in our province. It shows that the contents in syllabus teaching affect communicative ability of the students. It also explains the teachers’ effective delivery of the required knowledge to the learners. The survey method was adopted for this study. Agriculture University Peshawar, students were the population of the research. Data is collected through questionnaire.

Influence of planting time and bud numbers on growth of Schefflera arboricola propagated through cutting

Influence of timing and bud numbers on growth of Schefflera arboricola propagated through cutting in Peshawar was studied at Ornamental Nursery, Department of Horticulture Khyber Pakhtunkhwa Agricultural University Peshawar, during May-July 2010. The experiment was performed using Randomized Complete Block Design (RCBD) having two factors with split plot arrangement. The cuttings of Schefflera arboricola was planted on seven different dates i.e. 15 th May, 25 th May, 05 th June, 15 th June, 25 th June, 05 th July 15 th July. Four different sizes of cuttings were used in the experiments i.e. cuttings with one bud, cuttings with two, three and four buds. The planting time had significant effect on most of growth parameters. The result of the experiment showed that the Schefflera cuttings planted on 15 th July, 2010 gave maximum survival percentage (71.19%), sprout length (6.93 cm), number of branch plantleaf area (4.80 cm²), sprout thickness (0.44 cm), number of root plantroot length (22.17 cm) and root weight (1.24 gm). Whereas earliest sprouting (37.01 days) was observed in cuttings planted on 15 th July. The different sizes of cuttings had significant response on vegetative propagation of Schefflera through cutting. Cuttings with one bud gave best results for maximum survival percentage (78.49%), sprout length (7.81 cm), number of branches plantleaf area (4.91 cm²), sprout thickness (0.41cm), number of root plantroot length (21.90 cm) and root weight (1.47 gm). Whereas, the earliest sprouting (36.82 days), was observed in cuttings having four buds. The interaction of plantings times and cuttings sizes showed that the Schefflera cuttings with one bud when planted on 15 th July, 2010 gave best results in all parameters except

Effect of Drought Stress on Tomato cv. Bombino

To study “the effect of drought stress on Tomato (Lycopersicon esculentum) Cv. Bombino” an experiment was conducted at Institute of Biotechnology and Genetic Engineering, Agricultural University Peshawar. Tomato plants were grown in green house under two different conditions of water availability i.e.- controlled and drought. The parameters studied were relative water content (%), proline content (μmoles) and relative growth rate (week?1). Drought stress has significant effect on all parameters studied. The relative water content of plant body decline during drought due to less water availability. In controlled environment, the mean value of relative water content was 89.28 while that observed in drought condition was 87.73. Proline was observed on rise due to continuous decrease in water quantity in cell sap. The value of proline content is 4.4 μmoles g?1 fresh weight in controlled condition whereas that the plants in drought condition had 5.8 μmoles g?1 fresh weight. Due to less water, photosynthesis was negatively affected which resulted in less energy production and finally low growth. In controlled condition the relative growth rate week?1 on fresh weight was 1.37 gm whereas that of plant in drought condition was 0.57 gm.

Antimicrobial activity of mycelial extracts of Rhizopus stolonifer against different fungal and bacterial pathogenic strains

The aim of our research was to investigate the hidden antimicrobial potential of Rhizopus stolonifer against some selected fungal and bacterial pathogenic strains. The research work was done in the laboratory of Agricultural Chemistry, Department of Agricultural Chemistry, Agriculture University Peshawar, Khyber Pakhtunkhwa, Pakistan during the month of May 2013. The agar well diffusion method was used. The extracts in Acetonitrile and n-hexane were used. The result of all the extracts of Rhizopus stolonifer was found to be effective against all the tested fungal pathogenic strains i.e. A. niger, A. oryzae, C. albican, P. digitatum, F. oxysporum and Bacterial pathogens P. aeruginosa, E. coli, S. aureus, S. aureus (Methicillin resistant), S. aureus (Vancomycin resistant), The result of the extracts of R. stolonifer is quite effective in Acetonitrile solvent as compared to results in n-hexane. Minimum inhibitory concentration (MIC), of the extracts against these bacterial and fungal strains were in the range of 0.25 mg/ml. Different phytochemical analysis result indicate the presence of secondary metabolites like mycotoxin, Aflatoxin (B1, B2, G1and G2), which may be responsible for antimicrobial potential. From my result it is concluded that extracts of Rhizopus stolonifer have potential against all fungal and bacterial pathogenic strains.

In vitro antimicrobial study of Aspergillus flavus mycelial extract against different bacterial and fungal pathogenic strains

The aim of our research was to determine the antimicrobial activity of Aspergillus Flavus against some selected bacterial and fungal pathogen. The research work was done in the laboratory of Agricultural Chemistry, Department of Agricultural Chemistry, Agriculture University Peshawar, Khyber Pakhtunkhwa, Pakistan during the month of May 2013. The agar well diffusion method was used. The Acetonitrile and n-hexane extracts were used. The result of both the extracts of Aspergillus flavus was found to be effective against all the tested Bacterial i.e. P. aeruginosa, E. coli, S. aureus, S. aureus (Methicillin resistant), S. aureus (Vancomycin resistant), and fungal pathogen A. niger, A. oryzae, C. albican, P. distalatum, F. oxysporum. The result in Acetonitrile solvent was quite good from the result in n-hexane fraction, which confirmed that the secondary metabolites are more soluble in acetonitrile. Minimum inhibitory concentration (MIC), of the extracts against these bacterial and fungal strains were in the range of 0.20 mg/ml. Different phytochemical analysis result indicate the presence of secondary metabolites like mycotoxin, Aflatoxin, Kojic acids which may be responsible for antimicrobial properties. From our result is the concluded that extract of Aspergillus flavus have potential against fungal and bacterial strains.

Effects of non-genetic factors on age at first conception and calving interval in Holstein cattle under subtropical conditions

Fertility is a major trait and key factor to profitable dairy farming but at the same time often a limiting element in attempts to increase the milk production. Data on 517 lactation records of Holstein cattle maintained at Agricultural University Peshawar Dairy Farm in Pakistan from the period 1999 to 2010 were studied. The effect of various non- genetic factors i.e. sire, parity, season year of birth/calving on age at first conception (AFC) and calving interval (CI) were investigated using fixed effect model by GLM procedure of SAS 9.1. The effect of sire and season year of birth was highly significant (P<0.01) on AFC, whereas, highly significant effect of parity (P<0.01) and significant (P<0.05) effect of season year of calving on CI was observed. Mean AFC and CI were 709.9±71.9 days and 425.3±97.7 days, respectively. Under subtropical conditions the focus is always on milk performance while reproduction is often overlooked, due to which reproductive traits were found considerably inferior to those of temperate conditions. Even under subtropical conditions improvement trends were observed across years for both the traits. Therefore, managerial interventions supplemented by improved genetic potential are proposed to optimize these important reproductive traits.

Genetic Divergence in Bread Wheat F3 Populations for Morphological and Yield Traits

To study genetic divergence for morphological traits in bread wheat F3 populations, an experiment was conducted comprising 13 F3 populations and 6 parental cultivars during 2011-2012 at Khyber Pakhtunkhwa (KP) Agricultural University Peshawar, Pakistan. The experiment was conducted in randomized complete block design (RCBD) with three replications. Results of the data exhibited significant (P≤0.01) variation among wheat genotypes regarding days to heading, days to maturity, flag leaf area, spikes m -2 , grains spike -1 , grain weight spike -1 , 1000-grain weight and grain yield. Differences among parental (P) cultivars and F3 populations were also highly significant for all the traits. Differences among the P vs F3 were also significant for all the traits except 1000-grain weight. Heritability estimates for all the traits varied between 0.72-0.97. Genetic advance were 2.30 days for days to heading, 2.25 days for days to maturity, 5.54 cm 2 for flag leaf area, 175.22 spikes for spikes m -2 , 12.13 for grains spike -1 , 0.42 g for grain weight spike -1 , 8.81 g for 1000-grain weight and 683.16 kg ha -1 for grain yield. Based on the results of this study, G-98/PS-2004 and PS-2005/FS in

Prevalence and Perceptions about Migraine among Students and Patients in Khyber Pakhtunkhwa Province, Pakistan

Migraine is a common neurological disorder, prevalent in almost all over the world population and being considered as the 13th major medical disorder among other major disorders across the globe, generally characterized with unilateral or bilateral headache, nausea and vomiting. In developing world, countries like Pakistan, most of the patients are not well aware of migraine headaches, as usually taken for simple headache due to no proper awareness. Usually it is not a contagious condition and most of the time it is recoded as episodic in nature. To assess the migraine, its frequency, symptoms, usual triggers and patients’ perceptions, the present study was conducted. For this purpose a prospective study was carried out based on properly designed questionnaire. The data were collected from 7 educational institutes, including students of Islamia College Peshawar, University of Peshawar, Khyber Medical College, Engineering University Peshawar, Fatima Jinnah College Peshawar, Commerce College Peshawar and Agriculture University Peshawar. Part of data was also collected from patients visiting Khyber Teaching Hospital Peshawar for their headache problems. A total of 270 questionnaires were filled up. About 81 (30.00%) headache cases were recorded, fulfilling the International criteria of Headache. Out of 81 recorded cases, 31 (38.3%) patients were of migraine with aura and 50 (61.7%) were of migraine without aura condition. The prevalence of migraine in the study population was found to be 30.00%. The frequency of female migraine patients was higher i.e. 31 (34.1%) than the male sufferers 50 (27.9%). The present study clearly showed that the higher frequency (65.0%) of migraine exists in the age group of above 30 years age. The most prevalent trigger was found to be tension, which was in parallel followed by the lack of sleep or oversleeping. A family history for migraine was found in migraine patients. Usually the condition was found to limit the routine activities of patients. The present study recorded that most of the migraine patients (40.2%) did not visit doctors at hospital and preferably go for self-medication, which really needs a public awareness in order to properly cope this neurological disorder, which may pose future medical complications as well.

Response of Fodder Maize to Various Levels of Nitrogen and Phosphorus

Nitrogen (N) and Phosphorus (P) are of the most important and complex nutrients for the crop plants in particular for grain yield and quality. The field trials were laid out in randomized complete block design having three replications. Research trial plots were located at Agricultural Research Farm of Agricultural University Peshawar (Ameer Mohammad Khan Campus Mardan) during kharif season in 2012 to investigate the response of maize variety (Jalal) to three phosphorus rates (60, 90 and 120 kg&middotha-1) and four nitrogen rates (90, 120, 150, 180 kg&middotha-1) for agronomical traits. These traits investigated included number of plant per m2 (NP m2), plant height (PH), number of leaves plant-1 (NLP), leaf area plant-1&middotcm2 (LAP), fresh weight of plants kg&middotha-1 (FW) and dry weight of plant kg&middotha-1 (DW), were investigated. Results of the study showed that application of N @ 180 and P @ 120 kg&middotha-1 significantly increased fodder yield of maize. The linear increase in biomass yield clearly indicated that N was a limiting nutrient factor and that N demand along with P has a positive response. At higher application rates, N fertilizer significantly increased biomass component, improved N uptake with increasing nitrogen use efficiency and decreased its losses to the environment and below plant zone. So this study showed that the phosphorus and nitrogen fertilizers have a positive effect on the fodder yield of maize.