African Swine Fever Research Articles

Identification of predilection sites for wild boar carcass search based on spatial analysis of Latvian ASF surveillance data

Targeted search for wild boar carcasses is essential for successful control of African swine fever (ASF) in wild boar populations. To examine whether landscape conditions influence the probability of finding ASF-positive carcasses, this study analyzed Global Positioning System (GPS) coordinates of Latvian wild boar carcasses and hunted wild boar, extracted from the CSF/ASF wild boar surveillance database of the European Union, and random coordinates in Latvia. Geographic information system (GIS) software was used to determine the landscape type and landscape composition of carcass detection sites and to measure distances from the carcasses to nearest waterbodies, forest edges, roads and settlements. The results of the automated measurements were validated by manually analyzing a smaller sample. Wild boar carcasses were found predominantly in forested areas and closer to waterbodies and forest edges than random GPS coordinates in Latvia. Carcasses of ASF-infected wild boar were found more frequently in transitional zones between forest and woodland shrub, and at greater distances from roads and settlements compared to ASF-negative carcasses and random points. This leads to the hypothesis, that ASF-infected animals seek shelter in quiet areas further away from human disturbance. A detailed collection of information on the environment surrounding carcass detection sites is needed to characterize predilection sites more accurately.

Development of Highly Sensitive Conventional PCR for African Swine Fever Virus Diagnosis in East Nusa Tenggara (NTT) Province

African Swine Fever (ASF) adalah penyakit menular pada babi dengan tingkat mortalitas mencapai 100%. Pada tahun 2019, penyakit ini sebabkan wabah pada provinsi Nusa Tenggara Timur (NTT), dimana merupakan provinsi penghasil babi terbesar di Indonesia. PCR masih digunakan sebagai alat diagnosa untuk deteksi ASF virus (ASFV). Lepas dari sensitifitas dan spesifitasnya mencapai 90%, hasil dari PCR untuk mendeteksi ASGV masih memberikan false negatives pada beberapa laboratorium. Sehingga, tujuan dari penelitian ini adalah untuk mengembangkan PCR yang sangat sensitif untuk deteksi ASFV secara akurat di NTT. Metode penelitian dimulai dengan penentuan tipe dari sampel, primers setup, ekstraksi DNA, pencampuran master mix, proses amplifikasi, dan elektroforesis. Hasil PCR menunjukkan bahwa ASFV dideteksi pada hati, ginjal, dan limpa dari babi yang mati di Kabupaten Kupang, NTT dengan menggunakan primer : 5' CGCAGAGGTAAGCTTTCAGG 3' (forward primer) dan 5' GCCGATACCACAAGATCAGC 3' (reverse primer) dari gen p72. Panjang produk PCR mencapai 372 bp. Sehingga, hasil studi ini dapat diaplikasikan sebagai referensi bagi laboratorium di NTT dalam mendiagnosa ASF sehingga penyakit tidak menyebar dengan cepat dan menyebabkan wabah berikutnya.

African swine fever virus proteins against host antiviral innate immunity and their implications for vaccine development

African Swine Fever Virus (ASFV) poses a significant threat to global swine populations, necessitating a profound understanding of viral strategies against host antiviral innate immunity. This review synthesizes current knowledge regarding ASFV proteins and their intricate interactions with host defenses. Noteworthy findings encompass the modulation of interferon signaling, manipulation of inflammatory pathways, and the impact on cellular apoptosis. The implications of these findings provide a foundation for advancing vaccine strategies against ASFV. In conclusion, this review consolidates current knowledge, emphasizing the adaptability of ASFV in subverting host immunity. Identified research gaps underscore the need for continued exploration, presenting opportunities for developing targeted vaccines. This synthesis provides a roadmap for future investigations, aiming to enhance our preparedness against the devastating impact of ASFV on global swine populations.

Infection of domestic pigs with a genotype II potent strain of ASFV causes cytokine storm and lymphocyte mass reduction.

The whole-genome sequence of an African swine fever virus (ASFV) strain (HuB/HH/2019) isolated from Hubei, China, was highly similar to that of the Georgia 2007/1 strain ASFV. After infection with strong strains, domestic pigs show typical symptoms of infection, including fever, depression, reddening of the skin, hemorrhagic swelling of various tissues, and dysfunction. The earliest detoxification occurred in pharyngeal swabs at 4 days post-infection. The viral load in the blood was extremely high, and ASFV was detected in multiple tissues, with the highest viral loads in the spleen and lungs. An imbalance between pro- and anti-inflammatory factors in the serum leads to an excessive inflammatory response in the body. Immune factor expression is suppressed without effectively eliciting an immune defense. Antibodies against p30 were not detected in acutely dead domestic pigs. Sequencing of the peripheral blood mononuclear cell transcriptome revealed elevated transcription of genes associated with immunity, defense, and stress. The massive reduction in lymphocyte counts in the blood collapses the body's immune system. An excessive inflammatory response with a massive reduction in the lymphocyte count may be an important cause of mortality in domestic pigs. These two reasons have inspired researchers to reduce excessive inflammatory responses and stimulate effective immune responses for future vaccine development.

Postmanufacturing techniques for mitigation of viral pathogens in porcine-derived feed ingredients: a review.

African swine fever virus (ASFV) is a highly infectious virus known to cause substantial mortality and morbidity in pigs. The transmissibility and severity of disease within pigs, as well as the potentially resultant catastrophic trade ramifications, warrant its status as a foreign animal disease of substantial concern to the United States. The ASFV virus can survive for extended periods of time outside its host, and its greatest concentration is often observed in blood and organs, products that are frequently used as raw materials to manufacture porcine-derived ingredients fed to animals in the United States. Unlike ruminant-based proteins that cannot be fed to ruminant animals, it is permissible to feed porcine-derived ingredients to pigs in the United States. However, the increased threat of ASFV entry into the United States and our evolving understanding of viral transmission by feedstuffs warrant further investigation into this practice. The objectives of this review are to describe the current knowledge of ASFV survival in raw materials used to produce porcine-based ingredients, identify priorities for future research, and summarize potential options for managing risk until additional knowledge can be gained. While limited data is available for ASFV-specific mitigation, the temperatures used in both spray-drying and rendering have proven to effectively reduce viral concentrations of multiple swine viruses below detectable limits. However, some of these procedures may not eliminate the risk of recontamination, which necessitates the need for additional prevention or mitigation measures. Most published research in this area relies on direct inoculation of raw ingredient, not the finished porcine-derived ingredient. Currently, three published studies report ASFV mitigation in either thermally processed conditions (>40 °C) or ingredient quarantine (<40 °C). Virus inactivation, or the reduction of viral concentrations below detectable levels, was observed in the thermally processed study and one of the two ingredient quarantine studies. In conclusion, there is little knowledge to eliminate the risk of recontamination in porcine-derived ingredients; therefore, future research should aim to support and validate the currently available literature for the continued and safe production of porcine-derived ingredients in the event of a foreign animal disease outbreak.

Spatio-temporal dynamics and distributional trend analysis of African swine fever outbreaks (2020-2021) in North-East India.

African swine fever (ASF) is a highly contagious, notifiable, and fatal hemorrhagic viral disease affecting domestic and wild pigs. The disease was reported for the first time in India during 2020, resulted in serious outbreaks and economic loss in North-Eastern(NE) parts, since 47% of the Indian pig population is distributed in the NEregion. The present study focused on analyzing the spatial autocorrelation, spatio-temporal patterns, and directional trend of the disease in NE India during 2020-2021. The ASF outbreak data (2020-2021) were collected from the offices of the Department of Animal Husbandry and Veterinary Services in seven NE states of India to identify thepotential clusters, spatio-temporal aggregation, temporal distribution, disease spread, densitymaps, and risk zones. Between 2020 and 2021, a total of 321 ASF outbreaks were recorded, resulting in 59,377 deaths. The spatial pattern analysis of the outbreak data (2020-2021) revealed that ASF outbreaks were clustered in 2020 (z score = 2.20, p < .01) and 2021 (z score = 4.89, p < .01). Spatial autocorrelation and Moran's I value (0.05-0.06 in 2020 and 2021) revealed the spatial clustering and spatial relationship between the outbreaks. The hotspot analysis identified districts of Arunachal Pradesh, Assam and districts of Mizoram, Tripura as significant hotspots in 2020 and 2021, respectively. The spatial-scan statistics with a purely spatial and purely temporal analysis revealed six and one significant clusters, respectively. Retrospective unadjusted, temporal, and spatially adjusted space-time analysis detected five, five, and two statistically significant (p < .01) clusters, respectively. The directional trend analysis identified the direction of disease distribution as northeast-southwest (2020) and north-south (2021),indicatethe possibility of ASF introduction to India from China. The high-risk zones and spatio-temporal pattern of ASF outbreaks identified in the present study can be used as a guide for deploying proper prevention, optimizing resource allocation and diseasecontrol measures in NE Indian states.

In silico simulation of hyperoside, isoquercetin, quercetin, and quercitrin as potential antivirals against the pNP868R protein of African swine fever virus.

African swine fever (ASF) causes disease in pigs with up to 100% mortality rates. There is no effective vaccine to protect against it. This study aimed to perform in silico docking of ASF virus (ASFV) pNP868R protein with potential flavonoid ligands to identify ligands that interfere with mRNA cap formation. The ASFV pNP868R protein was tested with hyperoside, isoquercetin, quercetin, and quercitrin in this in silico simulation. ASFV pNP868R protein was extracted from the Research Collaboration for Structural Bioinformatics Protein Data Bank (RCSB PDB) database with PDB ID 7D8U (https://www.rcsb.org/structure/7D8U). Standard ligands were separated from proteins using UCSF Chimera 1.13. The standard ligand was redocked to protein using AutoDockTools 1.5.6 with the AutoDock4 method for validation. In the docking process, the grid box size was 40 × 40 × 40 Å3 with x, y, and z coordinates of 16.433, -43.826, and -9.496, respectively. The molecular docking process of the proposed ligand-protein complex can proceed if the standard ligand position is not significantly different from its original position in the viral protein's pocket. The root mean square deviation (RMSD), root mean square fluctuation (RMSF), and radius of gyration (RoG) of the hyperoside with the lowest energy binding need to be analyzed with molecular dynamics using Groningen machine for chemical simulation 5.1.1. Molecular docking and dynamic simulation revealed that hyperoside had the most stable and compact binding to the pNP868R protein. Hyperoside binds to the protein at the minimum energy of -9.07 KJ/mol. The RMSD, RMSF, and RoG values of 0.281 nm, 0.2 nm, and 2.175 nm, respectively, indicate the stability and compactness of this binding. Hyperoside is the most likely antiviral candidate to bind to the pNP868R protein in silico. Therefore, it is necessary to test whether this flavonoid can inhibit mRNA capping in vitro and elicit the host immune response against uncapped viral mRNA.

Blood meal metabarcoding of the argasid tick (Ornithodoros turicata Dugès) reveals extensive vector‐host associations

AbstractMolecular methods to understand host feeding patterns of arthropod vectors are critical to assess exposure risk to vector‐borne disease and unveil complex ecological interactions. We build on our prior work discovering the utility of PCR‐Sanger sequencing blood meal analysis that work well for soft ticks (Acari: Argasidae), unlike for hard ticks (Acari: Ixodidae), thanks to their unique physiology that retains prior blood meals for years. Here, we apply blood meal metabarcoding using amplicon deep sequencing to identify multiple host species in individual Ornithodoros turicata soft ticks collected from two natural areas in Texas, United States. Of 788 collected O. turicata, 394 were evaluated for blood meal source via metabarcoding, revealing 27 different vertebrate hosts (17 mammals, five birds, one reptile, and four amphibians) fed upon by 274 soft ticks. Information on multiple hosts was derived from 167 individual O. turicata (61%). Metabarcoding revealed mixed vertebrate blood meals in O. turicata while same specimens yielded only one vertebrate species using Sanger sequencing. These data reveal wide host range of O. turicata and demonstrate the value of blood meal metabarcoding for understanding the ecology for known and potential tick‐borne pathogens circulating among humans, domestic animals, and wildlife such as relapsing fever caused by Borrelia turicatae. Our results also document evidence of prior feeding on wild pig from an off‐host soft tick for the first time in North America; a critical observation in the context of enzootic transmission of African swine fever virus if it were introduced to the US. This research enhances our understanding of vector‐host associations and offers a promising perspective for biodiversity monitoring and disease control strategies.

Seroprevalence of African Swine Fever in Appearently Healthy Pig Farming in Chad

Seroprevalence of African Swine Fever in Appearently Healthy Pig Farming in Chad

Reconstruction and analysis of the transmission network of African swine fever in People's Republic of China, August 2018-September 2019.

Introduction of African swine fever (ASF) to China in mid-2018 and the subsequent transboundary spread across Asia devastated regional swine production, affecting live pig and pork product-related markets worldwide. To explore the spatiotemporal spread of ASF in China, we reconstructed possible ASF transmission networks using nearest neighbour, exponential function, equal probability, and spatiotemporal case-distribution algorithms. From these networks, we estimated the reproduction numbers, serial intervals, and transmission distances of the outbreak. The mean serial interval between paired units was around 29 days for all algorithms, while the mean transmission distance ranged 332 -456 km. The reproduction numbers for each algorithm peaked during the first two weeks and steadily declined through the end of 2018 before hovering around the epidemic threshold value of 1 with sporadic increases during 2019. These results suggest that 1) swine husbandry practices and production systems that lend themselves to long-range transmission drove ASF spread; 2) outbreaks went undetected by the surveillance system. Efforts by China and other affected countries to control ASF within their jurisdictions may be aided by the reconstructed spatiotemporal model. Continued support for strict implementation of biosecurity standards and improvements to ASF surveillance is essential for halting transmission in China and spread across Asia.

Study on the mortality pattern of African Swine Fever in pigs during an outbreak in Ranchi, Jharkhand

Study on the mortality pattern of African Swine Fever in pigs during an outbreak in Ranchi, Jharkhand

Reclassification of ASFV into 7 Biotypes Using Unsupervised Machine Learning.

In 2007, an outbreak of African swine fever (ASF), a deadly disease of domestic swine and wild boar caused by the African swine fever virus (ASFV), occurred in Georgia and has since spread globally. Historically, ASFV was classified into 25 different genotypes. However, a newly proposed system recategorized all ASFV isolates into 6 genotypes exclusively using the predicted protein sequences of p72. However, ASFV has a large genome that encodes between 150-200 genes, and classifications using a single gene are insufficient and misleading, as strains encoding an identical p72 often have significant mutations in other areas of the genome. We present here a new classification of ASFV based on comparisons performed considering the entire encoded proteome. A curated database consisting of the protein sequences predicted to be encoded by 220 reannotated ASFV genomes was analyzed for similarity between homologous protein sequences. Weights were applied to the protein identity matrices and averaged to generate a genome-genome identity matrix that was then analyzed by an unsupervised machine learning algorithm, DBSCAN, to separate the genomes into distinct clusters. We conclude that all available ASFV genomes can be classified into 7 distinct biotypes.

The attenuated African swine fever vaccine HLJ/18-7GD provides protection against emerging prevalent genotype II variants in China

ABSTRACT Genetic changes have occurred in the genomes of prevalent African swine fever viruses (ASFVs) in the field in China, which may change their antigenic properties and result in immune escape. There is usually poor cross-protection between heterogonous isolates, and, therefore, it is important to test the cross-protection of the live attenuated ASFV vaccines against current prevalent heterogonous isolates. In this study, we evaluated the protective efficacy of the ASFV vaccine candidate HLJ/18-7GD against emerging isolates. HLJ/18-7GD provided protection against a highly virulent variant and a lower lethal isolate, both derived from genotype II Georgia07-like ASFV and isolated in 2020. HLJ/18-7GD vaccination prevented pigs from developing ASF-specific clinical signs and death, decreased viral shedding via the oral and rectal routes, and suppressed viral replication after challenges. However, HLJ/18-7GD vaccination did not provide solid cross-protection against genotype I NH/P68-like ASFV challenge in pigs. HLJ/18-7GD vaccination thus shows great promise as an alternative strategy for preventing and controlling genotype II ASFVs, but vaccines providing cross-protection against different ASFV genotypes may be needed in China.

Food loss and waste in the Philippines: a literature review

Malnutrition has been one of the significant challenges the world is facing, with food insecurity as the main driver. However, as strategies focus on increasing production for a more secure food system, food loss and waste (FLW) exist as food is transferred to each supply chain player and even during consumption. The study aimed to provide information on the current state of food loss and waste in the Philippines. FLW during consumption is more detrimental as each step input adds value to the food item. In the Philippines, where every single grain is vital, the Food Waste Reduction Act was introduced. This law aimed to reduce food waste through donations and recycle food as fertilizer or compost. Aside from the staple rice, other agricultural commodities with more than 20% waste at postharvest are bananas, cabbage, calamansi, eggplant, mangoes, sweet potato, and tomato. The food industry also plays a vital role in reducing waste, and some identified recommendations are creating a weekly menu to avoid buying too much, storing food properly and strict practice of first-in-first-out to minimize spoilage, promoting food preservation processing to utilize and extend shelf life of in-season fruits and vegetable and reducing the serving sizes. Other contributors to food waste are the surge of zoonotic diseases such as the African Swine Fever (ASF) and natural disasters. Considering all the players and contributors, FLW is indeed multi-faceted, and to reduce it warrants collaborative efforts of various agencies to continuously launch awareness campaigns, implement the use less of or do without concept to avoid leftovers and improve methods of storing foods and develop FLW measurement protocols whereby targets are set and FLW are regularly monitored. It is high time that FLW is in the spotlight to curb the lack of consistent access to food among the poor.

Generation and Characterization of Recombinant Pseudorabies Virus Delivering African Swine Fever Virus CD2v and p54.

African swine fever (ASF) leads to high mortality in domestic pigs and wild boar, and it is caused by the African swine fever virus (ASFV). Currently, no commercially available vaccine exists for its prevention in China. In this study, we engineered a pseudorabies recombinant virus (PRV) expressing ASFV CD2v and p54 proteins (PRV-∆TK-(CD2v)-∆gE-(p54)) using CRISPR/Cas9 and homologous recombination technology. PRV-∆TK-(CD2v)-∆gE-(p54) effectively delivers CD2v and p54, and it exhibits reduced virulence. Immunization with PRV-∆TK-(CD2v)-∆gE-(p54) neither induces pruritus nor causes systemic infection and inflammation. Furthermore, a double knockout of the TK and gE genes eliminates the depletion of T, B, and monocytes/macrophages in the blood caused by wild-type viral infection, decreases the proliferation of granulocytes to eliminate T-cell immunosuppression from granulocytes, and enhances the ability of the immune system against PRV infection. An overexpression of CD2v and p54 proteins does not alter the characteristics of PRV-∆TK/∆gE. Moreover, PRV-∆TK-(CD2v)-∆gE-(p54) successfully induces antibody production via intramuscular (IM) vaccination and confers effective protection for vaccinated mice upon challenge. Thus, PRV-∆TK-(CD2v)-∆gE-(p54) demonstrates good immunogenicity and safety, providing highly effective protection against PRV and ASFV. It potentially represents a suitable candidate for the development of a bivalent vaccine against both PRV and ASFV infections.

Identification of the p34 Protein of African Swine Fever Virus as a Novel Viral Antigen with Protection Potential.

African swine fever (ASF) is a highly contagious disease caused by African swine fever virus (ASFV), affecting domestic and wild boars. The polyprotein pp220 of ASFV is responsible for producing the major structural proteins p150, p37, p14, p34, and p5 via proteolytic processing. The p34 protein is the main component of the ASFV core shell. However, the immunologic properties of the p34 protein in vitro and in vivo remain unclear. The results showed that the recombinant p34 protein expressed in prokaryotes and eukaryotes could react with convalescent swine sera to ASFV, suggesting that p34 is an immunogenic protein. Significantly, anti-p34 antibodies were found to inhibit the replication of ASFV in target cells. Furthermore, rabbits immunized with the recombinant C-strain of classical swine fever virus containing p34 produced both anti-p34 humoral and cellular immune responses. In addition, the p34 protein could induce a cell-mediated immune response, and a T-cell epitope on the p34 protein was identified using immunoinformatics and enzyme-linked immunospot (ELIspot) assay. Our study demonstrates that the p34 protein is a novel antigen of ASFV with protective potential.

[The I226R protein of African swine fever virus inhibits the cGAS-STING-mediated innate immune response].

This study aimed to explore the mechanism of how African swine fever virus (ASFV) I226R protein inhibits the cGAS-STING signaling pathway. We observed that I226R protein (pI226R) significantly inhibited the cGAS-STING-mediated type Ⅰ interferons and the interferon-stimulated genes production by dual-luciferase reporter assay system and real-time quantitative PCR. The results of co-immunoprecipitation assay and confocal microscopy showed that pI226R interacted with cGAS. Furthermore, pI226R promoted cGAS degradation through autophagy-lysosome pathway. Moreover, we found that pI226R decreased the binding of cGAS to E3 ligase tripartite motif protein 56 (TRIM56), resulting in the weakened monoubiquitination of cGAS, thus inhibiting the activation of cGAS and cGAS-STING signaling. In conclusion, ASFV pI226R suppresses the antiviral innate immune response by antagonizing cGAS, which contributes to an in-depth understanding of the immune escape mechanism of ASFV and provides a theoretical basis for the development of vaccines.

Retrospective Multi-Locus Sequence Analysis of African Swine Fever Viruses by "PACT" Confirms Co-Circulation of Multiple Outbreak Strains in Uganda.

African swine fever (ASF) is a haemorrhagic fever of swine that severely constrains pig production, globally. In Uganda, at least 388 outbreaks of ASF were documented from 2001 to 2012. We undertook a retrospective serological and molecular survey of ASF virus (ASFV) using banked samples collected from seven districts (Pallisa, Lira, Abim, Nebbi, Kabarole, Kibaale, and Mukono) of Uganda. Six assays (ELISA for antibody detection, diagnostic p72 gene PCR and genomic amplification, and sequencing of four gene regions (p72 [P], p54 [A], CVR of the 9RL-ORF [C], and TK [T]), hereinafter referred to as P-A-C-T (PACT)) were evaluated. Antibodies to ASFV were detected in the Abim district (6/25; 24.0%), and the remainder of the serum samples were negative (187/193; 96.9%). For the tissue samples, ASFV detection by assay was 8.47% for P, 6.78% for A, 8.47% for C, and 16.95% for T. The diagnostic PCR (p72 gene) detected seven positive animals from four districts, whereas the TK assay detected ten positives from all seven districts. In addition to the superior detection capability of TK, two virus variants were discernible, whereas CVR recovered three variants, and p72 and p54 sequencing each identified a single variant belonging to genotype IX. Our results indicate that dependence on serology alone underestimates ASF positivity in any infected region, that multi-locus sequence analysis provides better estimates of outbreak strain diversity, and that the TK assay is superior to the WOAH-prescribed conventional p72 diagnostic PCR, and warrants further investigation.

Sejarah Perdagangan Babi dari Pulau Bulan Batam ke Singapura, 1987-2023

This research delves into the pig trade history from Pulau Bulan, Batam, to Singapore spanning 1987 to 2023. In response to the 1984 policy eliminating domestic livestock farming, Singapore became reliant on imported meat. Employing a historical research method and drawing on literature reviews, the study identifies PT Indo Tirta Suaka's Pulau Bulan pig farm as Southeast Asia's largest and Singapore's primary live pig importer, initiating exports in 1987. Disruptions occurred, such as Singapore's cessation of pig supplies from Malaysia during Foot and Mouth Disease (FMD) outbreaks in Sarawak (1999-2017) and the Covid-19 pandemic. However, a significant setback unfolded with the detection of African Swine Fever (ASF) on April 19, 2023. Subsequent tests confirmed ASF in Pulau Bulan pig samples, prompting Singapore to officially halt pig supplies. This resulted in a substantial monthly and yearly loss of approximately IDR 3.5 billion and IDR 1.1 trillion, respectively, in pig exports from Pulau Bulan to Singapore.

The Long-Jumping of African Swine Fever: First Genotype II Notified in Sardinia, Italy.

African swine fever (ASF) is a devastating infectious disease of domestic pigs and wild boar that is spreading quickly around the world and causing huge economic losses. Although the development of effective vaccines is currently being attempted by several labs, the absence of globally recognized licensed vaccines makes disease prevention and early detection even more crucial. ASF has spread across many countries in Europe and about two years ago affected the Italian susceptible population. In Italy, the first case of ASF genotype II in wild boar dates back to January 2022, while the first outbreak in a domestic pig farm was notified in August 2023. Currently, four clusters of infection are still ongoing in northern (Piedmont-Liguria and Lombardy), central (Lazio), and southern Italy (Calabria and Campania). In early September 2023, the first case of ASFV genotype II was detected in a domestic pig farm in Sardinia, historically affected by genotype I and in the final stage of eradication. Genomic characterization of p72, p54, and I73R/I329L genome regions revealed 100% similarity to those obtained from isolates that have been circulating in mainland Italy since January 2022 and also with international strains. The outbreak was detected and confirmed due to the passive surveillance plan on domestic pig farms put in place to provide evidence on genotype I's absence. Epidemiological investigations suggest 24 August as the most probable time of ASFV genotype II's arrival in Sardinia, likely due to human activities.