Adjacent Base Pairs Research Articles

Measurement and interpretation of Q 0 and Q 1 band property changes of two cationic metalloporphyrins upon binding with B-DNA: electronic MCD, CD, and optical absorption

Room-temperature Q-band electronic MCD, CD, and optical spectra are reported for the first time for two free and nucleic acid-bound cationic metalloporphyrins. Metalloporphyrins are the high-symmetry ( C 4v or D 4h ) , four-coordinate tetragonal type MP( X) [M=Cu II and Pt II; P( X)= meso-tetrakis( X-N-methylpyridyl)porphine; X=2 or 4], and the nucleic acid is native, B-form calf thymus DNA (CT DNA). For intercalation system PtP(4)/CT DNA, large optical ( λ 0, ϵ max) and MCD ( λ peak, λ trough, A aj , A aj / D aj , and Δ[ θ] M p–t/ ϵ max) band parameter shifts, as well as a single negative (−) induced CD peak for each of Q 0 and Q 1, were observed upon binding of the porphyrin to chiral DNA. The directions and magnitudes of these changes are comparable to those observed for the Soret (B 0) band of this system. Decreases of MCD/optical ratio Δ[ θ] M p–t/ ϵ max(∝ A aj / D aj ) of 30% (Q 0) and 50% (Q 1) upon intercalation indicate substantial reductions of the Q 0[ 1 E u ( a) (0,0),∼1 a 1 u 1 4 e g 1] and Q 1[ 1 E u ( a) (0,1),∼1 a 1 u 1 4 e g 1] excited state angular momenta, 〈 L j 〉. It is of additional interest that intercalation leads to intensity cancellation of one of the four A-term lobes, the (+) lobe of the Q 0 MCD (+) pseudo-A-term, which was also observed previously for intercalation systems PdP(4)/poly(G–C) 2 and /CT DNA. Application of the CD sector method to the constituent x- and y-polarized porphyrin edtms, √ D aj , of the Q 0 (edtms μ 0 x and μ 0 y ) and Q 1 (edtms μ 1 x and μ 1 y ) CD bands leads to the conclusion that PtP(4) is symmetrically intercalated between adjacent GC base pairs, specifically at 5 ′GC3 ′ sites, with each of two adjacent 4- N-methylpyridyl groups extending into each of the major and minor grooves. For outside binder CuP(2), small optical and MCD band parameter shifts and smaller, single positive (+) induced CD peaks are observed for Q 0 and Q 1 upon interaction with CT DNA, similar to what is found for B 0. Little or no change in the MCD/optical ratio, Δ[ θ] M p–t/ ϵ max, informs that external binding has only small effects on the excited state angular momenta, 〈 L j 〉, of these bands. The composite of MCD, CD, and optical spectra are consistent with CuP(2) binding to CT DNA by one or both of two competing external modes, i.e., by an AT-specific, edge-on minor groove mode at 5 ′TA3 ′ sites and/or a face-on major groove mode with high selectivity for 5 ′AT3 ′ or 5 ′CG3 ′ sites. For Q 0 and Q 1 of each of the CuP(2)/CT DNA and PtP(4)/CT DNA systems, we observe that the genuine MCD (+) A-terms of these free MP(X)s retain their (+) sign on becoming pseudo-A-terms upon binding to the low-symmetry, asymmetric DNA sites, and this indicates that the external and intercalative modes result in the 4e g splitting, or ΔLUMO, being less than the |1a 1u–3a 2u| energy separation, or ΔHOMO.

B-DNA's BI → BII Conformer Substate Dynamics Is Coupled with Water Migration

The EcoRI DNA dodecamer d(CGCGAATTCGCG)2 is investigated by state-of-the-art molecular dynamics simulations. The BI → BII transition is shown to be a consequence of destacking processes of adjacent base pairs and is coupled with migration of water from ionic phosphate to the sugar oxygen. Two-thirds of the double-helical base steps temporarily are in the BII substate. The time-averaged BI/BII population ratio is 9.2, but at a given time, it can be as low as 2.7. Observed changes in the solvation properties closely match recently reported spectroscopic features. The different time scales of all processes involved are discussed with respect to experimental results. Formation of contact ion-pairs is demonstrated to be independent of substate transitions.

DNA bending: the prevalence of kinkiness and the virtues of normality.

DNA bending in 86 complexes with sequence-specific proteins has been examined using normal vector plots, matrices of normal vector angles between all base pairs in the helix, and one-digit roll/slide/twist tables. FREEHELIX, a new program especially designed to analyze severely bent and kinked duplexes, generates the foregoing quantities plus local roll, tilt, twist, slide, shift and rise parameters that are completely free of any assumptions about an overall helix axis. In nearly every case, bending results from positive roll at pyrimidine-purine base pair steps: C-A (= T-G), T-A, or less frequently C-G, in a direction that compresses the major groove. Normal vector plots reveal three well-defined types of bending among the 86 examples: (i) localized kinks produced by positive roll at one or two discrete base pairs steps, (ii) three-dimensional writhe resulting from positive roll at a series of adjacent base pairs steps, or (iii) continuous curvature produced by alternations of positive and negative roll every 5 bp, with side-to-side zig-zag roll at intermediate position. In no case is tilt a significant component of the bending process. In sequences with two localized kinks, such as CAP and IHF, the dihedral angle formed by the three helix segments is a linear function of the number of base pair steps between kinks: dihedral angle = 36 degrees x kink separation. Twenty-eight of the 86 examples can be described as major bends, and significant elements in the recognition of a given base sequence by protein. But even the minor bends play a role in fine-tuning protein/DNA interactions. Sequence-dependent helix deformability is an important component of protein/DNA recognition, alongside the more generally recognized patterns of hydrogen bonding. The combination of FREEHELIX, normal vector plots, full vector angle matrices, and one-digit roll/slide/twist tables affords a rapid and convenient method for assessing bending in DNA.

Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15.

The ribosomal protein S15 from Escherichia coli binds to a pseudoknot in its own messenger. This interaction is an essential step in the mechanism of S15 translational autoregulation. In a previous study, a recognition determinant for S15 autoregulation, involving a U.G wobble pair, was located in the center of stem I of the pseudoknot. In this study, an extensive mutagenesis analysis has been conducted in and around this U.G pair by comparing the effects of these mutations on the expression level of S15. The results show that the U.G wobble pair cannot be substituted by A.G, C.A, A.C, G.U, or C.G without loss of the autocontrol. In addition, the base pair C.G, adjacent to the 5' side of U, cannot be flipped or changed to another complementary base pair without also inducing derepression of translation. A unique motif, made of only two adjacent base pairs, U.G/C.G, is essential for S15 autoregulation and is presumably involved in direct recognition by the S15 protein.

Molecular genetic analysis of transposase-end DNA sequence recognition: cooperativity of three adjacent base-pairs in specific interaction with a mutant Tn5 transposase

Transposition of Tn5 and IS50 requires the specific binding of transposase (Tnp) to the end inverted repeats, the outside end (OE) and the inside end (IE). OE and IE have 12 identical base-pairs and seven non-identical base-pairs. Previously we described the isolation of a Tnp mutant, EK54, that shows an altered preference for OE versus IE compared to wild-type (wt) Tnp. EK54 enhances OE recognition and decreases IE recognition both in DNA binding and in overall transposition. Here we report that base-pairs 10, 11 and 12 of the OE are critical for the specific recognition by EK54 Tnp. These three adjacent base-pairs act cooperatively; all three must be present in order for EK54 Tnp to interact very favorably with the end DNA. The existence of only one or two of these three base-pairs decreases binding of EK54 Tnp. The combined use of EK54 Tnp and a new OE/IE mosaic end sequence containing the OE base-pairs 10, 11 and 12 gives rise to an extraordinarily high transposition frequency. Just as the Tnp is a multifunctional protein, the nucleotides in the 19 bp Tn5 ends also affect other functions besides Tnp binding. Furthermore, the fact that we were able to isolate end sequence variants that transpose at a higher frequency than the natural ends (OE and IE) with wt Tnp reveals yet another way in which the wt transposition frequency is depressed, i.e. by keeping the end sequences suboptimal.

S16020–2, a New Highly Cytotoxic Antitumor Olivacine Derivative: DNA Interaction and DNA Topoisomerase II Inhibition

S16020-2 (NSC-659687) is a new olivacine derivative that is highly cytotoxic in vitro and displays remarkable antitumor activity against various experimental tumors, especially some solid tumor models. Its antitumor activity is notably higher than that of 2-methyl-9-hydroxy-ellipticinium (NMHE) and comparable to that of doxorubicin HCl, although with a different tumor specificity. S16020-2 is being tested in phase I clinical trials. A study of the interaction of S16020-2 with DNA showed that it binds through intercalation between adjacent DNA base pairs, inducing an unwinding of 10 degrees of the double helix. Its DNA affinity is approximately equal to that of NMHE and decreases as a function of the salt concentration, indicating a significant electrostatic contribution to the overall binding free energy. S16020-2 did not interfere with the catalytic cycle of DNA topoisomerase I but stimulated DNA topoisomerase II-mediated DNA cleavage via a strictly ATP-dependent mechanism. The interactions of S16020-2 and NMHE with DNA topoisomerase II in vitro are very similar. Both drugs have the same DNA sequence specificity of cleavage and the same biphasic dose-effect response, and neither drug inhibited the rate of DNA religation. In contrast with these observations, in in vivo experiments, S16020-2 was able to induce topoisomerase II-mediated DNA strand breaks at concentrations 500-fold lower than NMHE. We conclude that DNA topoisomerase II most likely is the cellular target involved in the mechanism of cytotoxicity of S16020-2. Its higher biological activity and potency to induce cellular DNA cleavage suggest the involvement of as-yet-unidentified cellular factors.

Interactions between DNA polymerase beta and the major covalent adduct of the carcinogen (+)-anti-benzo[a]pyrene diol epoxide with DNA at a primer-template junction.

A molecular dynamics simulation has been carried out with DNA polymerase beta (beta pol) complexed with a DNA primer-template. The templating guanine at the polymerase active site was covalently modified by the carcinogenic metabolite of benzo[a]pyrene, (+)-anti-benzo[a]pyrene diol epoxide, to form the major (+)-trans-anti-benzo[a]pyrene diol epoxide covalent adduct. Thus, the benzo[a]pyrenyl moiety (BP) is situated in the single-stranded template at the junction between double- and single-stranded DNA. The starting structure was based on the X-ray crystal structure of the rat beta pol primer-template and ddCTP complex [Pelletier, H., Sawaya, M. R., Kumar, A., Wilson, S. H., and Kraut, J. (1994) Science 264, 1891-1903]. During the simulation, the BP and its attached templating guanine rearrange to form a structure in which the BP is closer to parallel with the adjacent base pair. In addition, the templating attached guanine is displaced toward the major groove side and access to its Watson-Crick edge is partly obstructed. This structure is stabilized, in part, by new hydrogen bonds between the BP and beta pol Asn279 and Arg283. These residues are within hydrogen bonding distance to the incoming ddCTP and templating guanine, respectively, in the crystal structure of the beta pol ternary complex. Site-directed mutagenesis has confirmed their role in dNTP binding, discrimination, and catalytic efficiency [Beard, W. A., Osheroff, W. P., Prasad, R., Sawaya, M. R., Jaju, M., Wood, T. G., Kraut, J., Kunkel, T. A., and Wilson, S. H. (1996) J. Biol. Chem. 271, 12141-12144]. The predominant biological effect of the BP is DNA polymerase blockage. Consistent with this biological effect, the computed structure suggests the possibility that the BP's main deleterious impact on DNA synthesis might result at least in part from its specific interactions with key polymerase side chains. Moreover, relatively modest movement of BP and its attached guanine, with some concomitant enzyme motion, is necessary to relieve the obstruction and permit the observed rare incorporation of a dATP opposite the guanine lesion.

Protonic Quantum Correlations in the H‐Bond Dynamics of Nucleic Acids. Part II. Correlations along the helical axis of protein‐coding DNA of living organisms

AbstractDue to their small mass, adjacent protons (or H‐atoms) of molecular systems may exhibit quantum entanglement (or quantum correlations), even at ambient conditions. The considerable thermal disturbance and/or manybody interactions of condensed matter and the associated decoherence effect, however, cause this protonic entanglement to be restricted in space and time. Some aspects of entanglement and decoherence are mentioned. Extending our previous theoretical work, in the present paper the focus is on the possible existence of entangled protons belonging to the H‐bonds of adjacent base pairs of B‐type DNA. Based on the ‘working hypothesis’ that this effect does really exist, the most probable ‘positions’ for the appearance of protonic entanglement in DNA sequences are qualitatively determined. Furthermore, these ‘positions’ appear to correspond uniquely to dimers of adjacent base pairs of DNA. As a consequence, one can straightforwardly search for an enhanced appearance of such entangled H‐bonds in DNA sequences of living organisms, using the existing DNA databases. A quantitative analysis of protein‐coding DNA sequences of various organisms has been performed, the results of which provide strong evidence for the existence of the considered effect. The most striking finding may be summarized as follows: Quantum entanglement appears preferably between the third base of a codon and the first base of the following one. Quantitative estimates of this and further obtained results are presented. It is also shown that quantum‐chemical considerations of stacking energies cannot account for the results. The new findings provide first evidence for the biological significance of entangled H‐bonds.

Hybrid oligomer duplexes formed with phosphorothioate DNAs: CD spectra and melting temperatures of S-DNA.RNA hybrids are sequence-dependent but consistent with similar heteronomous conformations.

Knowledge of the relative stabilities of S-DNA.RNA hybrids of different sequences is important for choosing RNA targets for hybridization with antisense phosphorothioate oligodeoxyribonucleotides (S-DNAs). It is also important to know how hybrid secondary structure varies with sequence, since different structures could influence thermal stability and the activity of RNase H. Our approach has been to study relatively simple sequences consisting of repeating di-, tri-, and tetranucleotides, which allow the maximum resolution of nearest-neighbor effects. Circular dichroism (CD) spectra and melting temperatures were acquired for 16 hybrid sequences that could be formed by mixing S-DNA and RNA oligomers of 24 nucleotides in length. CD spectra of S-DNA.RNA hybrids were sequence-dependent and were similar to those of analogous unmodified hybrids. From singular value decomposition, the major CD spectral component was like that of the A-conformation. Three nearest-neighbor relationships among the hybrid CD spectra were in as good agreement as are such relationships among spectra of duplex RNAs. Tm values ranged from 44.1 degrees C for S-d(ACT)8. r(AGU)8 to 66.6 degrees C for S-d(CCT)8.r(AGG)8 (in 0.15 M K+, phosphate buffer, pH 7). The S-DNA.RNA hybrids had a sequence-dependence of melting temperatures that was approximately the same as that calculated using published data for normal DNA.RNA hybrids [Sugimoto, N., Nakano, S., Katoh, M., Matsumura, A., Nakamuta, H., Ohmichi, T.,Yoneyama, M., & Sasaki, M. (1995) Biochemistry 34, 11211-11216]. In general, sequence-dependent CD spectra and Tm values of S-DNA.RNA hybrids appear to reflect the unique nearest-neighbor interactions of adjacent base pairs, where the S-DNA and RNA strands are in different, but relatively uniform, conformations.

Investigation of the structural basis for thermodynamic stabilities of tandem GU wobble pairs: NMR structures of (rGGAGUUCC)2 and (rGGAUGUCC)2.

The symmetric, tandem GU mismatch motifs, and , which only differ in the mismatch order, have an average difference in thermodynamic stability of 2 kcal/mol at 37 degrees C. Thermodynamic studies of duplexes containing these motifs indicate the effect is largely localized to the mismatches and adjacent base pairs. The three-dimensional structures of two representative duplexes, (rGGAGUUCC)2 and (rGGAUGUCC)2, were determined by two-dimensional NMR and a simulated annealing protocol. Local deviations are similar to other intrahelical GU mismatches with little effect on backbone torsion angles and a slight overtwisting between the base pair 5' of the G of the mismatch and the mismatch itself. Comparisons of the resulting stacking patterns along with electrostatic potential maps suggest that interactions between highly negative electrostatic regions between base pairs may play a role in the observed thermodynamic differences.

Influence of Drug Binding on DNA Flexibility: A Normal Mode Analysis

DNA-drug complexes are important because of their pharmacological interest but, in addition, they provide a useful model to study the essential aspects of DNA recognition processes. In order to investigate the influence of ligand binding on the dynamic properties of DNA we have carried out normal mode analysis for complexes with drugs of two types: a typical intercalator, 9-aminoacridine, and a typical groove binder, netropsin. Normal modes are analysed in terms of helicoidal parameter variations with special attention being paid to global deformations of the double helix. The results show that the influence of these two drugs is very different. Intercalation of 9-aminoacridine leads to an increase in the flexibility of the intercalated dinucleotide step, with notably larger vibrational amplitudes for both roll and twist parameters compared to free DNA. In contrast, the groove binding of netropsin induces a stiffening of the DNA segment which is in contact with the drug reflected by decreased vibrational amplitudes for backbone angles and inter base pair helicoidal parameters and an increase in vibrations for adjacent base pairs in terms of buckle and propeller twist.

The structure of an RNA “kissing” hairpin complex of the HIV TAR hairpin loop and its complement

We have used nuclear magnetic resonance (NMR) to obtain the structure of an RNA “kissing” hairpin complex formed between the HIV-2 TAR hairpin loop and a hairpin with a complementary loop sequence. Kissing hairpins are important in natural antisense reactions; their complex is a specific target for protein binding. The complex has all six nucleotides of each loop paired to form a bent quasicontinuous helix of three coaxially stacked helices: two stems plus a loop-loop interaction helix. Experimental constraints derived from heteronuclear and homonuclear NMR data on 13C and 15N-labeled RNA led to a structure for the loop-loop helix with an average root-mean-square deviation of 0.83 (±0.10) Å for 33 converged structures relative to the average structure. The loop-loop helix of the kissing complex is distorted compared to A-form RNA. Its major groove is blocked by the phosphodiester bonds that connect the first loop residue of each hairpin with its own stem, and it is flanked by two negatively charged phosphate clusters. The loop-loop helix has alternating helical twists between adjacent base-pairs. The base-pairs at the helix junctions are overwound and three base-pairs near the helix junctions adopt high propeller twists. All these changes reduce the distance needed for the bridging phosphodiester bonds connecting each stem and loop to cross the major groove of the loop-loop helix, and result in a deformed RNA helix with localized perturbations in the minor groove surface. The alternating helical twist pattern, plus other distortions in the loop-loop helix may be important for Rom protein recognition of the kissing hairpin complex.

A transcriptional enhancer required for the differential expression of the human estrogen receptor in breast cancers.

Breast cancers lacking estrogen receptor (ER) expression have an adverse prognosis and fail to respond to endocrine therapy. We have identified a transcriptional enhancer in the human ER gene which is differentially active in ER-positive (ER+) and ER-negative (ER-) human breast cancer cell lines. Enhancer function was mapped to a 35-bp element located from -3778 to -3744 upstream of the major human ER mRNA start site, which we have termed ER-EH0 (for estrogen receptor enhancer). Gel retardation assays with ER+ and ER- cell lines identified multiple DNA-protein complexes which specifically form on this enhancer. One of these complexes could be supershifted by anti-Jun or anti-Fos antibodies, identifying it as an AP-1-containing complex. Methylation interference assays suggest binding of factors to both the AP-1 site and adjacent base pairs. Enhancer activity requires both the AP-1 site and these adjacent sequences. Mutations introduced into ER-EH0 and the recently described proximal promoter element ERF-1 in the context of the full-length promoter confirm ER-EH0 as the dominant cis-acting element involved in differential ER expression.

Helix bending as a factor in protein/DNA recognition

Normal vectors perpendicular to individual base pairs are a powerful tool for studying the bending behavior of B-DNA, both in the form of normal vector plots and in matrices that list angles between vectors for all possible base pair combinations. A new analysis program, FREEHELIX, has been written for this purpose, and applied to 86 examples of sequence-specific protein/DNA complexes whose coordinates are on deposit in the Nucleic Acid Data Base. Bends in this sample of 86 structures almost invariably follow from roll angles between adjacent base pairs; tilt makes no net contribution. Roll in a direction compressing the broad major groove is much more common than that which compresses the minor groove. Three distinct types of B-DNA bending are observed, each with a different molecular origin: (1) Localized kinking is produced by large roll at single steps or at two steps separated by one turn of helix. (2) Smooth, planar curvature is produced by positive and negative roll angles spaced a half-turn apart, with random side-to-side zigzag roll at intermediate points, rather than a tilt contribution that might have been expected theoretically. (3) Three-dimensional writhe results from significant roll angles at a continuous series of steps. Writhe need not change the overall direction of helix axis, if it is continued indefinitely or for an integral number of helical turns. A-DNA itself can be formally considered as possessing uniform, continuous writhe that yields no net helix bending. Smooth curvature is the most intricate deformation of the three, and is least common. Writhe is the simplest deformation and is most common; indeed, a low level of continuous writhe is the normal condition of an otherwise unbent B-DNA helix of general sequence. With one exception, every example of major kinking in this sample of 86 structures involves a pyrimidine–purine step: C–A/T–G, T–A, or C–G. Purine–purine steps, especially A–A, show the least tendency toward roll deformations. © 1998 John Wiley & Sons, Inc. Biopoly 44: 361–403, 1997

Helix bending as a factor in protein/DNA recognition.

Normal vectors perpendicular to individual base pairs are a powerful tool for studying the bending behavior of B-DNA, both in the form of normal vector plots and in matrices that list angles between vectors for all possible base pair combinations. A new analysis program, FREEHELIX, has been written for this purpose, and applied to 86 examples of sequence-specific protein/DNA complexes whose coordinates are on deposit in the Nucleic Acid Data Base. Bends in this sample of 86 structures almost invariably follow from roll angles between adjacent base pairs; tilt makes no net contribution. Roll in a direction compressing the broad major groove is much more common than that which compresses the minor groove. Three distinct types of B-DNA bending are observed, each with a different molecular origin: (1) Localized kinking is produced by large roll at single steps or at two steps separated by one turn of helix. (2) Smooth, planar curvature is produced by positive and negative roll angles spaced a half-turn apart, with random side-to-side zigzag roll at intermediate points, rather than a tilt contribution that might have been expected theoretically. (3) Three-dimensional writhe results from significant roll angles at a continuous series of steps. Writhe need not change the overall direction of helix axis, if it is continued indefinitely or for an integral number of helical turns. A-DNA itself can be formally considered as possessing uniform, continuous writhe that yields no net helix bending. Smooth curvature is the most intricate deformation of the three, and is least common. Writhe is the simplest deformation and is most common; indeed, a low level of continuous writhe is the normal condition of an otherwise unbent B-DNA helix of general sequence. With one exception, every example of major kinking in this sample of 86 structures involves a pyrimidine-purine step: C-A/T-G, T-A, or C-G. Purine-purine steps, especially A-A, show the least tendency toward roll deformations.

RNA Duplex formation by oligodeoxynucleotides containing C-5 alkyne and C-5 thiazole substituted deoxyuridine analogs

The binding affinity of methyl substituted C-5 propyne and C-5 thiazole ODNs for RNA was assessed by thermal denaturation analysis (Tm). The results indicate that increased size of the alkyne substituent lead to decreased affinity, but certain methyl substitutions on the thiazole lead to higher affinity complexes with RNA. The increased affinity of methylthiazole ODNs to RNA was dependent on the position of the methyl substituent with 5-methylthiazole ODN ( 2h) exhibiting the highest Tm. The 5-methylthiazole group likely increases hydrophobic interactions with adjacent base pairs in the canonical double helix.

Comparative analysis of ribonuclease P RNA using gene sequences from natural microbial populations reveals tertiary structural elements.

PCR amplification of template DNAs extracted from mixed, naturally occurring microbial populations, using oligonucleotide primers complementary to highly conserved sequences, was used to obtain a large collection of diverse RNase P RNA-encoding genes. An alignment of these sequences was used in a comparative analysis of RNase P RNA secondary and tertiary structure. The new sequences confirm the secondary structure model based on sequences from cultivated organisms (with minor alterations in helices P12 and P18), providing additional support for nearly every base pair. Analysis of sequence covariation using the entire RNase P RNA data set reveals elements of tertiary structure in the RNA; the third nucleotides (underlined) of the GNRA tetraloops L14 and L18 are seen to interact with adjacent Watson-Crick base pairs in helix P8, forming A:G/C or G:A/U base triples. These experiments demonstrate one way in which the enormous diversity of natural microbial populations can be used to elucidate molecular structure through comparative analysis.

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.

Intercalation, DNA Kinking, and the Control of Transcription

Biological processes involved in the control and regulation of transcription are dependent on protein-induced distortions in DNA structure that enhance the recruitment of proteins to their specific DNA targets. This function is often accomplished by accessory factors that bind sequence specifically and locally bend or kink the DNA. The recent determination of the three-dimensional structures of several protein-DNA complexes, involving proteins that perform such architectural tasks, brings to light a common theme of side chain intercalation as a mechanism capable of driving the deformation of the DNA helix. The protein scaffolds orienting the intercalating side chain (or side chains) are structurally diverse, presently comprising four distinct topologies that can accomplish the same task. The intercalating side chain (or side chains), however, is exclusively hydrophobic. Intercalation can either kink or bend the DNA, unstacking one or more adjacent base pairs and locally unwinding the DNA over as much as a full turn of helix. Despite these distortions, the return to B-DNA helical parameters generally occurs within the adjacent half-turns of DNA.

The thermal stability of DNA fragments with tandem mismatches at a d(CXYG).d(CY'X'G) site.

Temperature-Gradient Gel Electrophoresis (TGGE) was employed to determine the thermal stabilities of 28 DNA fragments, 373 bp long, with two adjacent mismatched base pairs, and eight DNAs with Watson-Crick base pairs at the same positions. Heteroduplex DNAs containing two adjacent mismatches were formed by melting and reannealing pairs of homologous 373 bp DNA fragments differing by two adjacent base pairs. Product DNAs were separated based on their thermal stability by parallel and perpendicular TGGE. The polyacrylamide gel contained 3.36 M urea and 19.2 % formamide to lower the DNA melting temperatures. The order of stability was determined in the sequence context d(CXYG).d(CY'X'G) where X.X' and Y.Y" represent the mismatched or Watson-Crick base pairs. The identity of the mismatched bases and their stacking interactions influence DNA stability. Mobility transition melting temperatures (T u) of the DNAs with adjacent mismatches were 1.0-3.6 degrees C (+/-0.2 degree C) lower than the homoduplex DNA with the d(CCAG).d(CTGG) sequence. Two adjacent G.A pairs, d(CGAG).d(CGAG), created a more stable DNA than DNAs with Watson-Crick A.T pairs at the same sites. The d(GA).d(GA) sequence is estimated to be 0.4 (+/-30%) kcal/mol more stable in free energy than d(AA).d(TT) base pairs. This result confirms the unusual stability of the d(GA).d(GA) sequence previously observed in DNA oligomers. All other DNAs with adjacent mismatched base pairs were less stable than Watson-Crick homoduplex DNAs. Their relative stabilities followed an order expected from previous results on single mismatches. Two homoduplex DNAs with identical nearest neighbor sequences but different next-nearest neighbor sequences had a small but reproducible difference in T u value. This result indicates that sequence dependent next neighbor stacking interactions influence DNA stability.