Additional Mutations Research Articles

Can Vaccines Stop Cancer Before It Starts? Assessing the Promise of Prophylactic Immunization Against High-Risk Preneoplastic Lesions

Background: Cancer remains a leading cause of mortality with modest declines, highlighting the need for more efficacious prevention strategies like early immunological intervention against premalignant disease. Main body of abstract: Oncogenic viruses demonstrate prophylactic vaccines can successfully reduce malignancy by blocking precipitating infections. However, most cancers lack viral etiology, requiring novel approaches targeting sporadic precancerous states to enable early immunoprevention. Preneoplastic tissues exhibit biological changes making them appealing targets for stimulating immune surveillance before additional mutations cause unconstrained proliferation. High-risk precancers also provide sources of dysregulated self-antigens. Yet challenges exist in lesion identification, overcoming tolerance, and avoiding inflammation potentially worsening progression. Multidisciplinary insights into precancer immunology, predictive biomarkers, antigen discovery, and combinatorial vaccination strategies are illuminating rational vaccine design. Despite obstacles, prophylactic immunization against early dysplastic changes holds disruptive potential if key steps advance this approach. Elucidating preneoplasia immunobiology and progression risk modeling will be critical to guide productive immune targeting while mitigating immunotherapy hazards. Thoughtful translation could eventually shift paradigms by priming immunosurveillance against peak vulnerability lesions. Short Conclusion: Advancements in precancer vaccines may profoundly expand prevention horizons. Cautious immune targeting of premalignant states could intercept progression toward widely disseminated malignancies. This warrants methodical efforts to unravel the promise of thwarting lethal cancers before they start.

The Promising Third-Generation TKI Olverembatinib in Adult BCR::ABL1-Positive Acute Lymphoblastic Leukemia with T315I Mutation and Relapsed/Refractory Disease

Background Olverembatinib (HQP1351) is a novel third-generation tyrosine kinase inhibitor (TKI) that has shown remarkable efficacy and safety in chronic myeloid leukemia (CML). Still, few reports are available on BCR::ABL1-positive acute lymphoblastic leukemia (BCR::ABL1+ ALL). We first reported the early encouraging outcome of olverembatinib in BCR::ABL1+ ALL patients (pts) with T315I mutation or disease progression last year. Here, we enlarged the sample size and included a case of CML in lymphoid blast phase (CML-LBP) who also benefited from olverembatinib to a certain extent. Methods In this observational study, we retrospectively enrolled BCR::ABL1+ ALL or CML-LBP pts with T315I mutation, disease progression, or intolerant to previous TKIs in our institution from Dec. 2021 to May 2023. All pts received olverembatinib monotherapy (40mg qod) or combination therapy. Efficacy was assessed by CR rate, MRD negative (MRD <10 -4) rate by multiparameter flow cytometry (MFC), CMR (BCR-ABL1 transcript<10 -5) rate by RT-qPCR, as well as the survival data. PFS and OS were both calculated from the start of olverembatinib. Adverse events (AEs) were assessed and graded according to CTCAE v5.0. Results Totally, 30 pts with BCR::ABL1+ ALL (n=29) or CML-LBP (n=1) were analyzed. Among 29 BCR::ABL1+ ALL pts (median age of 60 years [range, 23-76]), 14 were in CR with molecular R/R disease, including 1 with MRD only detected by RT-qPCR. While the other 15 had hematological R/R disease, including 4 with central nervous system leukemia. T315I mutation was detected in 23 pts, including 8 with additional mutations. The baseline characteristics are detailed in Table 1. As for the 23-year-old female pt with CML-LBP, dasatinib was switched to olverembatinib when T315I, E255K, and E255V mutations were detected. T315I and E255V were eliminated rapidly after 1-month treatment of olverembatinib, while E255K still existed. At present, the patient maintained in CR, and blinatumomab will be used for MRD clearance before allo-HSCT. She was only included in the safety analysis. Among 14 pts with molecular R/R disease, 61.5% and 50% achieved MRD flow negativity and CMR with a median time of 1.3 months (range, 0.8-4.4) and 1.2 months (range, 0.9-4.4), respectively. Among 15 pts with hematological R/R disease, 80%, 53.3%, and 46.7% achieved CR/CRi, MRD flow negativity, and CMR, with a median time of 1 month (range, 0.2-2.5), 1 month (range, 0.2-3.3) and 2.1 months (range, 0.7-4.6), respectively. Totally, 8 pts underwent allo-HSCT with a median age of 48.5 years (range, 23-60), of which 6 pts achieved CMR before allo-HSCT, and all attained persistent CMR after allo-HSCT. By June 15, 2023, with a median follow-up time of 9.1 months (range, 1.7-16) in BCR::ABL1+ ALL pts, the median PFS was 7.8 months, and the median OS was not reached. For molecular R/R pts, the median PFS and OS were not reached, and for hematological R/R pts, the median PFS and OS were 6.5 and 8.6 months. MRD flow negativity or CMR responders had significantly better PFS and OS (PFS: p<0.001, p<0.001; OS: p<0.001, p<0.001), and bridging allo-HSCT after olverembatinib-based therapy showed a significant survival superiority (PFS: p=0.001; OS: p=0.017). Among the 23 pts with T315I mutation, the MRD flow negativity rate in pts with T315I single mutation was significantly higher than those with additional mutations (p=0.008), and the CMR rate tended to be better (p=0.089). Meanwhile, pts with T315I single mutation showed significant improvements in PFS and OS (Figure 1). As for safety analysis, the olverembatinib-based therapy was well-tolerated. Most non-hematological AEs were G1-2, and most G3-4 AEs were hematological, possibly related to chemotherapy. The incidence of G3-4 cardiovascular AEs was 6.7%. Five elderly pts (median age of 72 years [range, 63-76]) had temporary treatment suspension or dose reduction. No permanent discontinuation or death related to olverembatinib was observed. Conclusion This study further confirmed the efficacy of olverembatinib-based therapy in Chinese adults BCR::ABL1+ ALL pts with T315I mutation or R/R disease, especially in those with T315I single mutation. In addition, bridging allo-HSCT after deeper molecular remission could further improve survival. The safety profiles were manageable, but there is still a need to explore the optimal dose in elderly pts.

Polytypic B-Cells, B-Cell Lymphoproliferative Disorders/Lymphomas, and Neoplastic T-Cells Divergently Differentiate from TET2-/ DNMT3A-Mutated Clonal Hematopoiesis in Patients with Follicular Helper T-Cell Lymphomas/Lymphoproliferative Disorders

Introduction: Patients with follicular helper T-cell lymphomas/lymphoproliferative disorders (TFH-LPDs) commonly develop B-cell lymphoproliferative disorders and lymphomas (B-LPDs), but the pathophysiology is incompletely understood. TFH-LPDs often arise from TET2-/ DNMT3A-mutated clonal hematopoiesis (CH). Here we show TET2/ DNMT3A mutations are commonly shared by polytypic B-cells (PBCs), B-LPDs, and TFH-LPDs, with the latter two often carrying additional unique mutations. Methods: Pathology database search at Memorial Sloan Kettering identified patients with TFH-LPDs and PBCs or B-LPDs available for genotyping. If available, myeloid cells were also genotyped. PBCs lacked aberrancies by morphology and flow cytometry (FC) immunophenotyping (including polytypic light chain expression). TFH-LPDs and B-LPDs were defined using International Consensus Classification criteria. Genotyping assays included targeted next-generation sequencing (NGS) with (n=13) or without (n=8; cases 1, 4, 9, 10, 15, 16, 17, 22) a matched germline control and droplet digital PCR (n=4; cases 2, 3, 5, 6). Genotyping was performed on bulk samples or FC-sorted cells, including T-, B-, and myeloid as available. In bulk samples, mutations with allele frequencies (VAFs) >2x the percentage of neoplastic T- and myeloid cells combined in B-LPD samples and of neoplastic T- and total B-cells in bulk blood (PB)/bone marrow (BM) samples were considered present in B-LPD or myeloid compartments, respectively. A >2% VAF cutoff was utilized. EBV status was assessed using EBER in situ hybridization on tissues, serum EBV DNA by quantitative PCR, and/or evaluation of off target EBV reads by NGS. Statistical analyses utilized Mann-Whitney U tests. Results: In total, 25 patients (10 female, 15 male; median age 70 [range 38-82] years) with TFH-LPDs (19 TFH lymphoma, angioimmunoblastic type, 4 TFH lymphoma, NOS, 2 T-LPD with TFH phenotype [defined by morphologically and/or immunophenotypically atypical T-cells with both TFH-like phenotypes and genomic alterations that did not fulfill morphologic criteria for diagnosis of lymphoma]) were identified. The TFH-LPDs harbored TET2 (25/25, 100%), DNMT3A (12/25, 48%), RHOA p.G17 (15/25, 60%), and IDH2 p.R172 (9/25, 36%) mutations (Figure 1A). PBCs from 11 patients were evaluated (7 EBV+, 3 EBV-, 1 EBV unknown; 5 from lymph node, 4 PB, 2 BM). PBCs from 7/11 (64%) shared identical TET2 (n=6; median VAF 0.11 [range 0.02 - 0.27]) and/or DNMT3A (n=3; median VAF 0.05 [range 0.03-0.49]) mutations with corresponding TFH-LPDs. PBCs in 1 patient harbored a unique mutation ( TET2). Four of 8 (50%) patients in which myeloid cells were assessed harbored identical TET2 and/or DNMT3A mutations in the myeloid, PBC, and TFH-LPD compartments. B-LPDs were evaluated from 14 patients (5 diffuse large B-cell lymphoma, 5 polymorphic B-LPD, 2 follicular lymphoma, 1 B-LPD, NOS, 1 plasma cell myeloma; 11 EBV+, 3 EBV-; 9 from tissue, 4 PB, 1 BM). Polymorphic B-LPDs showed atypical polymorphic morphology and an abnormal B-cell immunophenotype by FC and/or a clonal IgH gene rearrangement. The B-LPD, NOS showed an abnormal CD5-/CD10- immunophenotype with light chain restriction by FC without available tissue for morphologic evaluation. Nine of 14 (64%) B-LPDs shared identical mutations with corresponding TFH-LPDs ( TET2 [n=9; median VAF 0.42 (range 0.10- 0.56)], DNMT3A [n=5; median VAF 0.27 (range 0.05-0.50)], TET3 [n=1; VAF 0.32]). Myeloid compartments in 9/12 (75%) patients shared identical TET2 and/or DNMT3A mutations with B- and/or T-LPDs. B-LPDs more commonly harbored additional mutations absent in corresponding TFH-LPDs than PBCs (12/14 [86%] vs 1/8 [13%] evaluated by NGS; p=0.001). Unique mutations in B-LPDs involved epigenetic/transcriptional regulation (n=14, e.g. TET2, KMT2D, SETD5), signaling pathways (n=22, e.g. DTX1, KRAS, EPHA5), and DNA damage response (n=3, e.g. ATM, CHEK2, BRCA2). Incidences of shared and unique mutations did not significantly differ among EBV+ and EBV- cases. Conclusions: Both PBCs and B-LPDs in TFH-LPD patients are commonly EBV+ and share TET2/ DNMT3A mutations with TFH-LPDs, consistent with common origin from CH. B-LPDs more often harbor additional unique mutations than PBCs. Thus, CH mutations and EBV activation in B-cells may predispose TFH-LPD patients to B-LPDs, which may develop with additional private genomic aberrations aiding transformation (Figure 1B).

The Impact of Baseline Genetic Profile and Treatment on Hematological Toxicity in CEBPA-Mutated Acute Myeloid Leukemia

Background: CEBPA-mutated acute myeloid leukemia (AML) is a separate entity in the updated WHO and ICC classifications. Previously identified by double mutations, the clinical profile and favorable outcome were correlated with in-frame mutations in bZIP domain. Beyond mutations recurrent in myeloid neoplasms (involving TET2, FLT3, NRAS), CEBPA-mutated AML is enriched in gene mutations (i.e., GATA2, CSF3R, WT1) rarely observed in CEBPA-wild type AML. No conclusive findings have been drawn for the prognostic impact of additional mutations. Of note, somatic GATA2 mutations have been associated with invasive fungal infections in myeloid neoplasms. Although overall correlating with favorable prognosis, an unexpectedly high rate of treatment-related mortality (TRM) in CR has been described in a large multicenter study on intensively treated CEBPA-mutated patients (pts) (Schlenk et al Blood 2013;122(9):1576). Aims: The aim of our study was to correlate baseline and treatment characteristics with the outcome and hematological toxicity in an intensively treated cohort of CEBPA-bZIP mutated AML pts. Methods: Pts entering the study had a diagnosis of CEBPA-bZIP AML confirmed according to 2022 WHO and ICC criteria. Pts were characterized by next-Generation deep amplicon sequencing with Ion Torrent platform (ThermoFisher Scientific) covering a panel of 40 genes. Sequence alignment and filtering were performed by NextGENe version 2.4.2.1 (SoftGenetics). The first two chemotherapy cycles were categorized according to the delivery of an anthracycline (ANTHRAC) and cytarabine (ARA-C) at high dose (HDAC). The study was approved by the local institutional review board. Results: From 2004 to 2023, 49 pts with CEBPA-bZIP mutated AML met the inclusion criteria at project study sites (Firenze, Bergamo). Their features are detailed in Table 1. CR rate was achieved in 45 of 49 pts (91.8%), with a DFS and OS of 74.3% and 82.4% at 5 y, respectively. Based on NGS, at least one additional mutation was identified in 18 (36.7%) pts (NGS+), the majority of them involving GATA2 (n=14, 28.6%). As per treatment, 44 pts received at least two cycles, of which no (n=2, 4.6%), one (n=14, 31.8%), or two (n=28, 63.6%) ANTHRAC-containing cycles. As regarded HDAC, 19 (43.2%), 17 (38.6%) and 8 (18.2%) pts received no, one or two HDAC-containing cycles, respectively. No significant differences emerged for DFS or OS between NGS+ and NGS- groups (P=0.33 and 0.52, respectively). To gain insight into potential causes of toxicity during CR, we focused on hematopoietic recovery after induction and consolidation. NGS+ pts showed slower neutrophil (ANC) recovery (median, 22 days to >500/uL after induction and 25 days after consolidation) compared to NGS- group (19 days, P=0.018; 18 days P=0.058, respectively). Such effect was enhanced by treatment with ANTHRAC-containing cycles: NGS+ pts receiving two cycles required significantly longer time to recover from first consolidation cycle, both for ANC (30 days) and platelet count (34 days) vs 22 (P=0.012) and 27 (P=.010) days, respectively, of other categories (Figure 1). A proportion of 45.5% (5/11) NGS+/ANTHRAC-2 pts could not complete the planned chemotherapy program due to hematological toxicity compared to 19.3% (6/31, P=0.09) in other categories. No significant prolongation of recovery was observed for HDAC. Conclusions: CEBPA-bZIP mutated AML is featured by high response rate and favorable outcome. Delayed hematopoietic recovery was observed in pts bearing additional mutations (especially GATA2) when treated with anthracyclines in first two cycles. Our findings suggest the cumulative dosage of anthracyclines should be limited in CEBPA-mutated/NGS+ patients to spare hematological toxicity on turn impairing the therapeutic plan.

Molecular and Cytogenetic Evaluation in Systemic Mastocytosis

Systemic mastocytosis (SM) is a rare hematological neoplasm characterized by pleomorphic symptoms, related to mediators release from pathological mast cells. Tissue infiltration of liver, spleen, gastro-intestinal (GI) tract and osteolysis are present in aggressive disease. As KIT D816V mutation can be found in approximately 80% of patients, several additional somatic mutations of prognostic significance have been detected in a subset of patients. We report on clinical, cytogenetic and molecular characteristic of 160 patients with SM diagnosed in the last 15 years at our center. Fourteen (8.9%) patients had cutaneous mastocytosis, 85 (53.5%) had indolent SM (ISM), 12 (7.5%) had smoldering SM (SSM), 27 (17%) had aggressive SM (ASM), 17 (10.5%) had SM with an associated hematological neoplasm (AHN-SM) and 1 (0.6%) had mast cell leukemia. Symptoms were mostly related to mediators release: itching and blistering (69, 43%), anaphylaxis (49, 30%), diarrhea/bloating (19, 12%), osteoporosis/bone fracture (10, 6%), constitutional symptoms (8, 5%), bone pain and myalgia (16, 10%), anaphylaxis from Hymenoptera venom (24, 15%). While SM patients were mostly treated with antihistamines and membrane stabilizers, 29 patients needed a disease modifying therapy. Four patients with ISM were treated with Interferon (IFN) for bone lytic alterations, while 1 patient with ISM started midostaurin for uncontrolled symptoms. Other 11 patients with ASM were treated with midostaurin: 4 responded, while 7 needed multiple lines of therapy including allogeneic transplant in 4 cases. Eleven patients with ASM were treated with tyrosin kinase inhibitors (TKI) before midostaurin became available, while 2 elderly patients were treated with low dose cytarabine and TKI for concomitant acute leukemia. KIT D816V mutation was found in 111 of 131 (85%) evaluable patients with SM. Cytogenetics was normal in all but 2 patients with AHN-SM in which a chromosomal gain was reported. Among 6 patients with ISM, KIT mutation was found in only 2 cases. One patient had isolated KIT mutation and was treated with IFN for skin symptoms and bone fracture, and another patient had a DNMT3A associated mutation and was treated with imatinib. Moreover, 1 patient presented both DNMT3A and TET2 mutations and was treated with IFN for bone fracture. Among 12 ASM patients, 1 was negative for significant mutations: no disease control was achieved after target therapy, and bone marrow function slowly recovered after allogeneic transplant. The most frequently recorded mutations were SRSF2 and TET2: they were present in 4 patients each and recorded together in 3 cases. Two patients with SRSF2 and TET2 mutations died after multiple lines of therapy: 1 patient for infection and graft versus host disease after allogeneic transplant and 1 for progressive disease. Moreover, the latter had additional RUNX1 mutation. Two patients with concomitant SRSF2 and IDH1 mutations and TET2 mutation respectively responded to midostaurin, while 1 with DNMT3A mutation received multiple lines of therapy and died for pneumonia. One patient with ASXL1 mutation responded to chemotherapy after 2 previous lines of treatment. Among 4 patients with isolated KIT mutation, 2 responded to midostaurin, 1 obtained a partial control of symptoms after 4 lines of treatment and 1 suddenly died after achieving stable disease after 2 lines of therapy. Among 3 patients with SM associated to myelodyplastic syndrome, 1 was negative for KIT but positive for TP53 mutations and died for natural event after symptoms directed therapy and continuing recombinant erythropoietin. The other 2 KIT positive patients presented multiple concomitant mutations. Additional TET2 and SRSF2 mutations were recorded in a patient who died few weeks after diagnosis, while additional TET2, SRSF2, RUNX1 and KRAS mutations were recorded in a patient treated with midostaurine and 2CDA before successful allogeneic transplant. Molecular characterization of SM has uncovered a complex landscape of somatic mutations other than KIT D816V. Although the prognostic significance of some recurrent mutations has been reported, prospective correlation with clinical response may highlighted their role in the pathogenesis of disease and possibly elucidate mechanism of resistance to treatment. On the other hand, cytogenetics might no be considered mandatory except for AHN-SM

UBA1 Mutations Identify a Rare but Distinct Subtype of Myelodysplastic Syndromes

Background Mutations in UBA1 are associated with VEXAS (Vacuoles, E1 enzyme, X-linked, Autoinflammatory, Somatic) syndrome, an adult-onset inflammatory disorder (Beck DB et al. NEJM 2020). Approximately 40% of VEXAS patients are also diagnosed with myelodysplastic syndromes (MDS). We previously profiled UBA1 p.M41 mutations in a select subset of the International Working Group for MDS (IWG-PM) cohort (Bernard E et al. NEJM Evid 2022) including 375 male patients lacking disease-defining mutations or established disease classification by WHO guidelines, and identified 28 patients (7%) with UBA1 p.M41T/V/L mutations (Cohort A, Sirenko M et al. Blood 2022). However, the prevalence and characteristics of UBA1 mutations in MDS have not been systematically evaluated in a representative MDS population. Methods We used targeted next-generation sequencing of the full UBA1 locus to profile 2027 diagnostic and treatment-naive MDS samples (Cohort B, 61% male) ascertained through the IWG-PM (Figure 1). Clinical associations of UBA1 mutations were evaluated and clinical history was reviewed for inflammatory conditions when available. Results In Cohort B, 35 UBA1 mutations in 34 (1.7%) patients were identified, of which 20 (0.97%) had likely pathogenic variants and 14 had variants of unknown significance (VUS). Likely pathogenic variants included 13 p.M41T/V/L mutation (variant allele fraction [VAF] range 0.013-0.94), and 7 non-p.M41 mutations where 6/7 had VAF>0.35: 2 with p.S56F (VAF 0.87 and 0.93), 2 p.A478S (VAF 0.72 and 0.80), 2 p.S621C (VAF 0.80 and 0.82) and 1 p.Y55H (VAF 0.025). Three VUS were in female patients. 204 cases were profiled by both assays and of those, all 8 ddPCR positive cases were identified by NGS with concordant VAF (R2=0.999 p<0.0001). Integration of Cohort A and B (n=2,198) yielded 40 patients (all male, median age 72; range 44-89 years) with pathogenic UBA1 variants. The WHO 2016 classification (available for n=38 of 40) was MDS-SLD/MLD (25), MDS-EB1 (4), MDS-U (3), CMML (2), MDS-RS-MLD (1), aCML (1), MDS/MPN-RS-T (1), MDS/MPN-U (1). Patients had a median of 1 myeloid gene mutation in addition to UBA1 (range: 0-4) with most frequent co-occurring events in TET2 (n=12), DNMT3A (n = 10), ASXL1 (n=3), SF3B1 (n=3) and loss of the Y chromosome (n=5). In 8 patients with pathogenic UBA1 > 2% VAF and co-occurring DNMT3A mutations, DNMT3A and UBA1 VAF were correlated (slope = 0.88, r = 0.87, p = 0.0005), suggesting that co-mutation may lead to clonal expansion. Conversely, TET2 co-mutations were either subclonal (n=4) or clonal (n=8) to UBA1. Among patients with pathogenic UBA1 variants, the majority had IPSS-M Very-Low/Low risk (73% 27/37). In contrast, patients with VUS were more likely to have Moderate or High risk (64% 7/11). Partial clinical history was available for 33 cases with pathogenic UBA1 variants. 50% (9/18) had inflammatory-rheumatic disease (IRD) including psoriatic arthritis, relapsing polychondritis, Sweet syndrome, bronchiolitis obliterans with organizing pneumonia, ear chondritis, and rosacea. 3 patients had more than one IRD. 8 were treated for IRD with steroids (n=6) or methotrexate (n=2). 4 patients had MGUS. Other manifestations included vacuoles (4/8), thromboembolic disease (5/16), non-infection fever (5/14), weight loss (4/14), ocular symptoms (5/15), arthralgia (3/16), chondritis (5/15), and other inflammation (6/14). IRD diagnosis usually preceded MDS (average time 0.28 years; range 16.5 years prior to 1.4 years after). Three patients transformed to acute myeloid leukemia (AML). One patient had a low VAF UBA1 p.M41V (0.0002 by ddPCR) and TET2, SF3B1, FLT3, and ASXL2 co-mutations at baseline. The second had UBA1 p.S56F (VAF 0.868) and a Chr 7q deletion. The third had VUS UBA1 p.R869L (VAF 0.222) and IRF1, NFE2 and RRAS co-mutations. Among the other UBA1-mutant patients that died or were censored after 1 year (n=37), none transformed to AML. Conclusion Within the large, representative, diagnostic and well-characterized IWG-PM MDS cohort, we find likely pathogenic UBA1 mutations in 1% of patients, with enrichment in male patients with few or no mutations in myeloid driver genes (7%). UBA1-mutant patients were predominantly IPSS-M low risk with a median of 1 additional mutation, usually in DNMT3A or TET2. UBA1 mutations may define a distinct subset of MDS and its recognition in future guidelines will improve the management of patients with MDS/VEXAS overlap.

Real World, Single-Centre Experience of Pregnancy in Patients with Philadelphia Negative Myeloproliferative Neoplasms

Pregnancy in myeloproliferative neoplasms (MPN) is commonly associated with maternal and foetal complications due to increased risks of thromboembolic and haemorrhagic events and placental dysfunction. The incidence of UK pregnancies in MPN is estimated as 3·2/100 000 maternities per year (Alimam, S., et al 2016, Br J Haematol 2016; 175:31-36; Robinson et al, Br J Haematol 2020;189:625-34). Here we present pregnancy outcomes of MPN patients attending University College London Hospital (UCLH), a large UK tertiary referral centre, between 2015 and 2023. Twenty-three patients were identified with a median age at MPN diagnosis of 33 years (range (r), 13 - 46). The majority of patients (21/23, 91.3%) had a diagnosis of ET or triple negative (TN) thrombocytosis and 8.7% (2/23) a diagnosis of polycythaemia vera (PV). In 61.4% of pregnancies, diagnosis was known at conception. Regarding mutational status, JAK2V617F was present in 10/23 (43.5%) patients, CALR in 5/23 (21.7%) and MPL in 1/23 (4.3%). The remaining 7/23 (30.4%) patients were TN. Median VAF for JAK2V617F and CALR were 15.8% (r, 21.1 - 33%) and 25.9% (r, 5.7 - 46%), respectively. The cohort collectively experienced 57 pregnancies, 38 of which were managed at UCLH. Focusing on pregnancies managed at UCLH, median age at pregnancy was 34.5 years (r, 22 - 47). Conception was spontaneous in 31/38 (81.6%) pregnancies. Six (15.8%) patients required assisted conception and had a higher median age of 38.5 years (r, 35 - 47). Where gestation at delivery was known, 92.6% (25/31) of live births delivered at term (>37 weeks). Caesarean rate was significant at 41.9% (13/31), of which 61.5% were emergency sections. The live birth rate of the 57 overall pregnancies was 76.9% and 88.6% in the 38 managed at UCLH. At UCLH, we adopt an individualised approach to managing pregnant women with MPNs, working alongside obstetricians and obstetric haematology colleagues. Consequently, as shown in Table 1, there were bespoke regimens for individual patients. Low dose aspirin was prescribed throughout pregnancy in the majority (78.9%, 30/38) of pregnancies. In 18.4% (7/38), cytoreduction was established prior to pregnancy. In 42.9% (3/7), pegylated interferon (PegIFN) was commenced to optimise counts prior to pregnancy and in 42.9% (3/7) as long term count control. One patient was cytoreduced with hydroxycarbamide prior to pregnancy and subsequently switched to PegIFN. Low molecular weight heparin (LMWH) was administered at some point during pregnancy in 60.9% (14/23) of patients and 57.9% (22/38) of pregnancies. 65.8% (25/38) underwent monitoring with uterine artery (UA) dopplers. Median gestation for UA assessment was 20 weeks (r, 19 - 28). UA dopplers were reported as abnormal in 16% (4/25). In two patients, this was due to a raised combined pulsatility index, UA notching in one and was unspecified in one patient. Nine (39.1%) patients experienced foetal loss, with 12 miscarriages recorded across the total 57 pregnancies and 4 miscarriages in the 38 pregnancies managed at UCLH. Median maternal age was 31.5 (r, 24 - 42) and median gestation was 8 weeks (r, 5 - 24). Six (66.7%) patients experiencing foetal loss had a diagnosis of ET, 2 (22.2%) PV and 1 (11.1%) TN thrombocytosis. Three miscarriages occurred in one patient, who demonstrated a concurrent heterozygous prothrombin G20210A mutation in addition to ET. Eight (34.8%, 8/23) patients collectively experienced 11 haemorrhagic events. The majority (72.7%) were post-partum haemorrhage (PPH), 37.5% of which were classified as major or severe. Three (27.3%) bleeding events occurred whilst on aspirin monotherapy, 3 (27.3%) on combined LMWH and aspirin, 1 (9.1%) on LWMH alone and 1 (9.1%) on LMWH and PIFN. With regards to thrombosis, one patient with undiagnosed ET had a cerebral venous sinus thrombosis at 11-weeks gestation. A total of 2/23 (8.7%) patients' pregnancies resulted in hypertensive complications and pre-eclampsia, both resulting in delivery with caesarean section at 34 and 35 weeks. Although the live birth rate is encouraging, our data highlights that patients with MPN remain at increased risk of miscarriage, early delivery and haemorrhagic events. There remain inconsistencies in the management of pregnancy in MPN and, although we adopt an individualised patient-centred approach, there is an unmet need for further study and development of evidence based treatment algorithms.

Single-Cell Long-Read Sequencing Enables the Dissection of BTK Subclonal Dynamics in CLL Treatment

Introduction: BTK inhibition is an effective frontline therapy for patients with CLL. However, patients who develop BTK C481S mutations relapse quickly. We recently published a longitudinal study investigating subclonal evolution in 38 patients receiving BTKi treatment for CLL. Of the 38 patients, 6 developed a subclone containing a BTK C481S mutation identified in the whole-exome sequencing (WES) data at the time of relapse. To understand whether a BTK C481S mutation alone can drive relapse or if an additional CLL-relevant mutation is required, we investigate these subclones on a single-cell level using PacBio Multiplexed Arrays Sequencing (MAS-seq). MAS-seq generates single-cell, long-read RNA sequencing data, which is highly accurate and provides coverage across the entire mRNA transcript. Methods: For each patient, B cells were isolated from a pre-BTKi treatment sample and a sample taken at the time of relapse. Single-cell cDNA library preps were generated using the 10X Genomics Chromium platform. The cDNA was then sequenced using MAS-Seq. After processing the MAS-seq data using PacBio's Isoseq pipeline, Seurat was used to perform a single-cell analysis for each sample. We used scBayes, a Bayesian-statistical approach developed in our lab (Qiao et al., Genome Research, in review), to assign subclone identity to individual cells based on the expression of previously identified somatic mutations. The transcript-wide coverage of MAS-seq increases the likelihood of coverage at the somatic mutation sites compared to traditional single-cell RNA sequencing methods. Results: We have sequenced and analyzed samples from 4 patients in this study (pt 1-4). In the pretreatment sample of pt 1, two subclones containing different TP53 mutations were present. At the time of relapse, a BTK C481S subclone evolved from one of these TP53 subclones, becoming the dominant clonal population. No other CLL-relevant mutations were detected in this patient. Pts 2-4 had an additional CLL-relevant mutation evolve with the BTK C481S mutation in the dominant subclone at the time of relapse. In pt 2, a subclone with an NFKBIE and the BTK mutation evolved from a cell population where BRAF, BCOR, and EGFR2 mutations were present. The BTK C481S subclone in Pt 3 also had new KMT2D and CREBBP mutations. This subclone evolved from a cell population with an ASXL1 and SF3B1 mutation. In pts 1-3, the BTK subclone was only seen at the time of relapse. Pt 4 did not have any CLL-relevant mutations identified before treatment. In a sample taken 6 months before relapse, a BTK C481S subclone is visible at a low frequency with no other CLL-relevant mutations. At the time of relapse, a DICER1 variant, a gene recently implicated in CLL (Knisbacher et al., Nature Genetics, 2022), evolved from the BTK subclone and is seen at the time of relapse as the dominant subclone. Furthermore, the full-transcript sequencing at the single-cell level enabled us to identify a second BTK C481S subclone present at the time of relapse and determine that it was independent of the subclone containing both the BTK C481S and DICER1 mutations. This second BTK subclone had no other CLL-relevant mutations and remained at a very low frequency. Conclusion: Single-cell long-read RNA sequencing via MAS-seq provides transcript-wide coverage, which enables genotyping at somatic mutation sites. Using this method, we found that the dominant relapse clones all contained a BTK C481S mutation, which either co-evolved with additional CLL-relevant mutations (3/4 patients) or occurred on the background of existing TP53 mutations (1/4 patients).

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

TP53 Y220C Mutations in Patients with Myeloid Malignancies

Background: TP53 gene mutations lead to inactivation of the protein p53, causing genome instability, oncogenesis, and treatment resistance conferring an unfavorable prognosis. TP53 Y220C missense mutations in exon 6 (p.659A>G) are described as a frequent ‘hot spot’ mutation in solid tumors. A novel Y220C-targeted small molecule (PC14586) has shown preliminary efficacy and safety in patients with solid tumors (Dumbrava, E., ASCO 2022). No data has been reported about TP53 Y220C in hematologic malignancies to date. We set out to evaluate the clinicopathologic characteristics of TP53 Y220C in hematologic malignancies and particularly, myeloid neoplasms. Methods: We identified all patients with hematologic neoplasms with TP53 Y220C mutations at University of Texas MD Anderson Cancer Center and Memorial Sloan-Kettering Cancer Center, detected by standard next generation sequencing assays, and focused on patients with myeloid malignancies; summarizing the patient characteristics, disease features and outcomes for patients with this specific TP53 mutation. Overall survival (OS) was assessed by the Kaplan-Meier method from date of diagnosis to date of death from any cause or date of last follow-up. Leukemia-free survival (LFS) was calculated from time to diagnosis of TP53 Y220C mutated myelodysplastic syndrome (MDS) to date of transformation to acute myeloid leukemia (AML) or death. Survival analysis was conducted only for newly diagnosed patients with available follow-up data. Results: We identified 143 patients (pts) with hematologic malignancies harboring a TP53 Y220C mutation. MDS and AML were the most frequent diagnoses (MDS, n=66; AML, n=48). Median age was 69 years (range, 32-92) and 56% of patients were male (Table 1). We then analyzed in more detail patients with MNs, including CHIP/CCUS, MDS, AML and MDS/MPN. Among those, in 76 (64%) pts the TP53 Y220C mutation was detected at initial diagnosis and in 43 (36%) pts, TP53 Y220C was identified in the relapsed/refractory setting. Therapy-related myeloid neoplasms (MNs) accounted for 51 of 119 pts (41%). Complex karyotype was frequent (n=88/119, 74%) in the setting of TP53 Y220C. Median TP53 Y220C variant allele frequency (VAF) was 32% (range, 1%-96%). Eighty-two patients (69%) had additional co-mutations: 24 (20%) pts had additional (non-Y220C) TP53 mutations only; 34 (29%) pts had only non- TP53 co-mutations (most frequently DNMT3A and TET2) and 24 (20%) pts had additional TP53 mutations in the setting of other co-mutations. With a median follow-up of 9 months, median OS for patients with newly diagnosed TP53 Y220C MDS (n=39) and AML (n=23) was 13.1 months (95% CI, 7.6 to 18.7) and 8 months (95% CI, 5.6 to 13.4), respectively ( p=0.06) (Figure 2). For the TP53 Y220C MDS cohort, AML transformation occurred in 13 (33%) patients, after a median of 14.3 months. Median LFS for these patients was 12.2 months (95% CI, 7.9 to 16.5). Modest and non-statistically significant differences in median LFS for MDS patients who did and did not receive stem cell transplant (SCT) were identified; MDS+SCT (n=12) 14.5 months (95% CI, 4 to 25) vs MDS+no-SCT (n=27) 9.3 months (95% CI, 4.6 to 14), p=0.18. Interestingly, four patients diagnosed with TP53 Y220C mutated CHIP/CCUS with a median VAF of 2% were identified, and with a median follow-up of 34.6 months, none have developed dysplastic changes or progression to MDS or AML at the time of cut off. Additional outcomes data will be forthcoming in the analysis of this cohort of patients with TP53 Y220C mutated myeloid neoplasms. Conclusions: TP53 Y220C mutations are present in malignant blood disorders and are particularly more common in myelodysplastic syndromes and acute myeloid leukemia, with associated poor outcomes. Novel targeted therapies for this TP53 variant (Y220C) would be of interest for this patient population.

Predicting the Clinical Course of Treatment with Midostaurin in Patients with Advanced Systemic Mastocytosis

Introduction: Advanced systemic mastocytosis (AdvSM) is characterized by presence of the KIT D816V mutation and variably other somatic mutations in the mast cell but also non-mast cell lineages, e.g. monocytes or eosinophils, in ≥80-90% of patients. Midostaurin is an approved multikinase/KIT inhibitor for treatment of AdvSM. The intricate landscape in assessment of response, resistance or progression, the occurrence of adverse events with its impact on dose modification and the recent approval of the specific KIT D816V inhibitor avapritinib contribute to complex decision-making. We here sought to characterize the most valuable baseline and on-treatment parameters for prediction of response and survival in midostaurin-treated patients with AdvSM. Methods: On basis of the ´German Registry on Disorders of Eosinophils and Mast Cells' (GREM), this retrospective-prospective analysis included 79 patients with AdvSM. Treatment was initiated between 2009 and 2022 accumulating into a 239 patient-years overall follow-up period. In addition to common serological, morphological, and molecular response parameters, we specifically examined the recurrent observation of an early flare-up in alkaline phosphatase (AP) levels, which was defined as a ≥25% AP increase within three months after treatment initiation, followed by a subsequent decline below baseline within six months. Results: Midostaurin was used in first-line (1L) or second and further lines (2L+; median 1 prior treatment line, range 0-4) in 63 (80%) and 16 (20%) patients, respectively. In 1L/2L+, median overall survival (OS) was 2.6/2.4 years. At baseline, the presence of additional somatic mutations in SRSF2 (n=36, 46%, HR 2.0 [1.2-3.6], P=0.014), ASXL1 (n=15, 19%, HR 2.0 [1.0-3.9], P=0.043), and EZH2 (n=6, 8%, HR 4.3 [1.7-11.3], P=0.003) significantly stratified patients according to their hazard ratio-weighted risk (median OS, 5.8 vs. 2.9 vs. 1.0 years; P<0.001). In 25 evaluable patients, the variant allele frequency in 72 additional somatic mutations remained stable (mean change 8%, absolute change >5% in 16/72 (22%) mutations). New mutations were identified in 9/25 (36%) patients during follow-up (Figure). Durable responses (complete, partial, clinical improvement) according to modified Valent criteria, IWG-MRT-ECNM criteria or Pure Pathological Response (PPR) criteria over a median duration between 12 and 24 months were achieved in 60%, 29% and 13% of patients, respectively. Within the first 12 months, duration of response was associated with an OS benefit ( P<0.001). An AP flare-up was observed in 22/79 (28%) patients, was paralleled by contemporaneous decrease of serum tryptase (median -35%, range -82 - 191%) and resulted into improved OS (median 5.8 vs. 2.2 years, P=0.007). Multivariable analysis identified the AP flare-up ( P=0.029), a ≥25% reduction of bone marrow (BM) mast cell (MC) infiltration ( P=0.046) and a ≥25% reduction of the KIT D816V expressed allele burden (EAB; P=0.034) at any time within the first 6 months as independent markers for improved OS (Table). Dynamic risk assessment of the independent parameters during follow-up allowed to abrogate a negative baseline risk-categorization. The initial dose was 200 mg/d (100 mg BID, including patients with a prespecified rapid dose escalation), 150 mg/d or 100 mg/d in 63/79 (80%), 2/79 (3%) and 14/79 (18%) patients, respectively. In the combined 150 mg and 100 mg cohorts, a dose increase to 200 mg/day was achieved in 9/16 (56%) patients. The 200 mg could be maintained at month 3, 6, 12, 24, and 36 in 50/63 (79%), 30/48 (63%), 23/34 (68%), 15/22 (68%) and 9/9 (100%) patients, respectively. Overall, 96 adverse events (AE) led to dose-adjustment (including temporary or permanent discontinuation). Hematologic and nonhematologic toxicities accounted for 24 (25%) and 36 (38%) of AEs with neutropenia (n=8, 8%) and nausea/emesis (n=22, 22%) being the most common AEs leading to dose-adjustment. Of note, the various dose levels had no impact on response or survival. Conclusions: Baseline mutations in SRSF2, ASXL1 and EZH2 conferred resistance to midostaurin. The various dose levels had no impact on response or survival. The on-treatment parameters AP flare-up, and a ≥25% reduction of BM MC infiltration and of KIT D816V EAB abrogated a negative baseline risk-categorization. No new safety signals occurred.

Calr Variant Allele Frequency in Essential Thrombocythemia: Molecular Associations and Impact on Disease Phenotype and Outcome

Background. A mutation in calreticulin ( CALRm) is found in 30-35% of patients (pts) with Essential Thrombocythemia (ET). There are 2 main CALRm mutation types, Type 1/Type 1 like (T1) a 52bp deletion, and Type 2/Type 2 like (T2) a 5bp insertion. Other atypical mutations (T3) occur in a minority of pts. Recent study ( Guglielmelli P et al, BCJ 2023) in pts with myelofibrosis (MF) showed that higher CALR variant allele frequency (VAF) was associated with anemia at diagnosis and during FU, and to features of more advanced disease (CD34 + cell counts, ASXL1 mutation (mut), >2 mutated myeloid genes, and shorter leukocytosis-free survival. Aim. To evaluate whether the CALRm VAF in pts with ET was associated with predefined major clinical outcomes: evolution to MF, transformation to acute leukemia (AML), thrombosis, major bleeding, and survival (OS). Patients and Methods. Diagnosis of ET was strictly according to 2023 WHO and ICC to avoid mis-inclusion of prefibrotic MF. CALRm VAF was determined by capillary gel electrophoresis as the ratio (%) of areas under the curve of CALRm/ CALRm+ CALRwt. A panel of 45 myeloid neoplasm-associated genes was sequenced by NGS. Results. A total of 281 CALRm ET pts were identified from CRIMM (Florence, I), Quebec MPN Research Group centers' (Canada) and Mayo Clinic (Rochester, US) databases; 152 (54%), 101 (36%) and 28 (10%) were T1, T2 and T3 CALRm, respectively. Overall FU was 8.6y (0.3-39.4), median survival was not reached. Rate of death at 10y, 20y and 30y was 8%, 15% and 25%. MF transformation occurred in 50 pts (18%), AML in 2 (0.7%), 25 pts (8.9%) died. A major thrombotic event before or at ET diagnosis occurred in 17 (6.0 %) pts (14 arterial and 3 venous), whereas 28 pts (10.0%) had >1 major thrombosis during follow-up (53.6% arterial, 46.4% venous). Major bleeding occurred in 19 pts (6.8%; 16 at or before diagnosis). Ascertainment of correlation of CALRm VAF with predefined outcomes by continuous variable analysis (ROC curve) highlighted a significant correlation of VAF >60% with MF-free survival (MFS), with HR of 2.85 (95%CI, 1.4-5.6; P= .002. Fig. 1A). On the contrary, there was no impact of CALRm VAF as continuous variable on AML, thrombosis, bleeding and OS. We therefore used a threshold of >60% to compare main clinical and hematologic characteristics at diagnosis and outcomes during FU in pts categorized as CALR-high and CALR-low. Of all pts, 21 (7.5%) harbored a VAF >60%; of these, 52%, 19% and 29% were T1, T2, T3, respectively, compared to 54%, 37%, 8% of CALR-low (P= .008). We found no difference in age, gender, constitutional symptoms, splenomegaly, arterial and venous thrombosis at diagnosis and FU, IPSET revised risk stratification, and bleeding events. Hemoglobin was lower (12.8 g/dL (8.4-14.0) versus 13.6 (10.1-16.0); P=.02), while leukocytes and platelets did not differ. The proportion of pts with additional mutations in myeloid genes was significantly greater in CALR-high pts compared to CALR-low (66.7% vs 30.2%; P=0.01), as it was the proportion of pts with >2 mut myeloid genes (25% vs 11.6%, P=0.04). During FU, 52% of CALR-high pts (n=11) transformed to MF compared to 15% (n=39) of CALR-low (P<.0001); AML and death not differ. Anemia (<10g/dL) during the FU developed in 69% of CALR-high pts vs 18%, leukocytosis (>15x10 9/L) in 46% vs 8% and splenomegaly (greater than 5 cm from LCM) in 50% vs 12% (P<.0001 for all). The HR for anemia-free survival was 2.87 (95%CI, 1.3-6.3), for leukocytosis HR 3.71 (95%CI, 1.3-10.5) and splenomegaly HR 3.40 (95%CI, 1.2-9.2), all P<.01. MFS was significantly shorter in T1 (HR 2.0; P=0.04) or T3 (HR 2.7; P=0.03) using T2 as reference. Finally, we compared C ALR-mut, JAK2V617F mut and triple-negative (TN) ET pts. ROC analysis indicated a JAK2VAF >35% ( JAK2-high) as the best cutoff for shorter MFS. As in Fig. 1B, the MFS survival of CALR-high and JAK2-high was superimposable, and significantly shorter that in CALR/JAK2-low and TN pts. Conclusions. A CALR VAF >60% in pts with ET is associated with greater risk and shorter time to MF progression, development of anemia and splenomegaly. Similar findings in JAK2-high pts reinforce that that accumulation of mutated CALR and JAK2 alleles, evident since diagnosis, is detrimental for evolution to post-ET myelofibrosis. Longitudinal studies after diagnosis might provide further information about the kinetics of allele accumulation.

Mutation of Epigenetic Regulators at Diagnosis Is an Independent Predictor of Tyrosine Kinase Inhibitor Treatment Failure: A Report from the Residiag Study

Introduction Additional mutations at chronic myeloid leukemia (CML) diagnosis have been shown to variably affect tyrosine kinase inhibitor (TKI) response and were inconstantly detected at loss of response. Contradictory observations may have resulted from difficulties in reliably inferring CML clonal architecture from mutations quantified by NGS, BCR::ABL1 by qRT-PCR, ABL1-TK by RNA-Seq. The RESIDIAG study was designed to identify at diagnosis molecular markers predictive of TKI treatment failure and analyze the clonal dynamics using asymmetric capture sequencing (aCAP-Seq). Methods DNA samples from 60 TKI responders (median follow-up: 7.1 years) were sequenced at diagnosis by aCAP-Seq, allowing quantification and breakpoint sequencing of genomic BCR::ABL1 fusion together with 43 myeloid genes, including ABL1 with a limit of detection of ~0.1% for BCR::ABL1 and 0.5-1% for SNVs and Indels. In parallel, CML patients who experienced treatment failure (ELN 2020) were sequentially analyzed at diagnosis and at failure (n=53), at diagnosis only (n=1), and at failure only (n=3). Small deletions and BCR::ABL1 breakpoints were analyzed to search for microhomology-mediated end-joining (MMEJ) repair signatures. Mutation analysis followed strict medical standards. Results The proportion of patients receiving imatinib at diagnosis wasn't statistically different (p=0.08; Pearson's Chi-square test) between responders (70%) and the failure group (56%). At diagnosis, the number of mutations was higher (p<0.001, t-test with Welch correction) in the failure group (0.9±0.1) as compared with responders (0.18± 0.05). ASXL1, DNMT3A, and TET2 were more frequently mutated at diagnosis in the failure group (38.6%, p<0.001; 10.5%, p=0.01, and 4.3%, p=0.025 respectively; Pearson's Chi²test) as compared with responders (6.7%, 0% and 0% respectively) and the presence of a mutation in one of these genes was highly associated with a reduced failure-free survival (p<0.001, Log-ranked test, Figure 1). An MMEJ signature at BCR::ABL1 breakpoints was more frequent (p=0.014, Pearson's Chi² test) in the failure group (29.1%) than in the responder group (9.1%). and was significantly associated with the ELTS score (p=0.005, Pearson's Chi² test) but not the Sokal score (p=0.017, Pearson's Chi² test). At first failure, 69% of patients had additional mutations in ASXL1 (39%), ABL1-TK (38%), DNMT3A (18%), or TET2 (15%), while other genes were rarely (<5%) mutated. ASXL1 mutations found at diagnosis were still detectable in 18/22 patients at failure and VAF suggested that double mutant BCR::ABL1/ ASXL1 clones were driving TKI failure with or without BCR:: ABL1 tyrosine kinase domain mutation (TKD). ASXL1 mutations disappearing upon treatment were mostly at low frequency <5% at diagnosis and thus possibly not clonally related to CML. Furthermore, a stepwise selection of variables followed by multivariate analysis with the Fine-Gray model identified the age of patients (sdHR [95% C.I.] = 0.99 [0.97-1.00]; p=0.08) and the presence of a mutation in epigenetics regulators at diagnosis as factors affecting the onset of TKD mutations (sdHR = 3.01 [1.76-5.15]; p<0.001). Intriguingly, co-occurring mutations in DNMT3A and TET2 were found in five patients at TKI failure. Their allelic frequency kinetics suggested that these belonged to the same clone driving CML relapse in 4/5 CML patients, while one patient also had a TKD mutation likely involved in CML relapse. Finally, multivariate COX regression analysis identified two independent predictors of TKI failure at diagnosis: a high-risk ELTS score (p=0.001; hazard ratio=3.42 [1.62-7.22] with low-risk as baseline) and a mutation in ASXL1, DNMT3A or TET2 (p=0.002; hazard ratio=2.87 [1.49-5.51]). Conclusion Altogether these results strongly point to the contribution of epigenetic regulator mutations in the emergence of TKI failure in CML and warrant further biological studies to better understand the underlying mechanisms

Clinical Characteristics, Genetic Profile and Prognosis of Adult Acute Myeloid Leukemia with NUP98 Rearrangement

Introduction: Nucleoporin 98 ( NUP98) rearrangement has been proposed in 2022 as one type of acute myeloid leukemia (AML) with defining genetic abnormalities. It occurred more often in pediatric leukemia with poor outcome. However, in adult AML with NUP98 rearrangement, patients may show different clinical characteristics, genetic profile and outcome, as we reported here. Method: We retrospectively collected and analyzed the data of adult AML patients with NUP98 rearrangement who were diagnosed at Shanghai Institute of Hematology from May 2019 to December 2022, including clinical characteristics, laboratory examination, genetic abnormalities, treatment strategies and outcome. All patients underwent next generation sequencing and RNA sequencing. Result: A total of 21 AML patients with NUP98 rearrangement were included in this study, counting for 2.3% of all AML patients (930 cases). The median age was 40 (19-64) years old. The median white blood cell and platelet count was 31.1 (1.5-313.6) and 48 (15-140) ×10 9/L, respectively. Interestingly, 11 (52.4%) patients suffered from severe or fatal hemorrhage irrelative with platelet count or coagulative function, including 4 cerebral bleeding (3 died), 1 urgent uterine bleeding, 1 gastro-intestinal bleeding, 1 retina bleeding and 4 massive bleeding of subcutaneous soft tissue or mucous membranes. The FAB types involved M2, M4 and M5. Eight patients carried normal karyotype, 6 were found with t(7;11)(p15;p15), all of whom had NUP98::HOXA9 fusion gene, 2 with +8 and 1 complex karyotype. According to ELN 2022 risk classification, 14 (66.7%) were at intermediate risk and 6 (28.6%) at adverse risk, 1 unclassified. Five fusion partners with NUP98 were detected: NUP98::NSD1 (11 cases), NUP98::HOXA9 (7 cases), NUP98::HOXA11, NUP98::HMGB3 and NUP98::TNRC18 (each with 1 case). Of which NUP98::TNRC18 was first reported by our center (see Cheng WY, et al. Proc Natl Acad Sci U S A. 2022;119(49):e2211429119). NUP98 rearrangement also co-existed with several mutations. FLT3-ITD (12 cases, of which 10 were co-existed with NUP98::NSD1) and WT1 (7 cases) were most frequently occurred. Patients with relapse/refractory disease had more additional mutations than de novo status (Figure 1). Nineteen patients were treated with standard dose of “7+3” induction therapy, and 2 with hypomethylating agents (HMA) plus venetoclax (VEN). Complete remission (CR) was achieved by 8 (38.1%) patients after first induction, 2 (9.5%) early deaths were both due to cerebral hemorrhage. Salvage induction varied from intensive chemotherapy (IC, including “7+3” and CLAG±M) to low-intensity therapy (LIT, including priming chemotherapy±HMA and HMA+VEN). FLT3 inhibitors (FLT3i) were added to 5 patients carrying FLT3-ITD, and they all achieved CR. A total of 15 (71.4%) patients achieved CR after 1-2 courses of induction (8 mainly benefited from IC, 7 mainly benefited from LIT±FLT3i), 1 survived from allogeneic hematopoietic stem cell transplantation (allo-HSCT) without reaching remission before, and 3 died from refractory disease within 6 months. Three patients relapsed after CR, 2 died without allo-HSCT, and the other one survived after CR2 and sequential allo-HSCT. A total of 14 patients underwent allo-HSCT after CR, 7 were measurable residual disease (MRD) negative and 7 were positive by flow cytometry before HSCT, none of them relapsed till the last follow-up. With a median follow-up time of 19.2 months, the median overall survival (OS) and event-free survival (EFS) were not reached, estimated 2-year OS and EFS rate were 66.7% and 57.1%, respectively. For patients achieving CR or not, the median OS were not reached vs 3.2 months (95% CI 0-8.361, P<0.001, Figure 2). Ten patients were diagnosed with NUP98::NSD1 co-occurring with FLT3-ITD (once considered as unfavorable prognosis), ending up with a CR rate of 70%, and a 2-year OS and EFS rate of 80% and 60%, respectively, making no significant difference compared to others ( P=0.236 and 0.725, respectively). Conclusion: Adult AML with NUP98 rearrangement may combine with a set of partner fusion genes and mutations, with NUP98::NSD1 and FLT3-ITD as the most common combination. Both IC an LIT can induce CR, and FLT3i will benefit those with FLT3 mutations, also prevention of fatal bleeding should be paid attention to. After achieving CR with whatever method and whatever MRD status, allo-HSCT is the key to long-term survival.

A Large Cohort Study of 412 Patients with SRSF2/TET2 Co-Mutated Myeloid Neoplasms: The Molecular Landscape and Clinical Outcomes

Introduction: Serine and arginine-rich splicing factor 2 ( SRSF2) and tet methylcytosine dioxygenase 2 ( TET2) are early mutations that drive the development of myeloid neoplasms and monocytosis. SRSF2/ TET2 co-mutations are most common in chronic myelomonocytic leukemia (CMML). However, they can also be seen in myelodysplastic syndrome (MDS), acute myeloid leukemia from CMML (AML-CMML), other AML (AML-Other, mostly de novo AML), and myeloproliferative neoplasms (MPN). Previous studies have investigated these co-mutations in myeloid diseases separately and as a subset (CMML) or small subset (MDS or AML) of the patients. Additionally, these studies mainly compared the clinical difference between patients with and without these double mutations. A large cohort study of patients with both mutations, irrespective of the morphologic diagnosis, has not been reported. Methods: Out of the Moffitt NextGen sequencing database of more than 8000 patients, we identified 412 patients with both SRSF2 and TET2 mutations and with diagnosed or suspected myeloid neoplasms. The demographics and clinical parameters were collected. Overall survival (OS) was defined as the time from sequencing to the last visit at Moffitt or death. Two experienced hematopathologists confirmed the final diagnosis according to the 5 th edition of the World Health Organization classification of hematological malignancies. Chi-squared tests of independence were used to compare the association between gene mutation and diagnosis, and a post hoc test based on adjusted standardized residuals was used. Cox proportional hazards models were used to compare the OS within and across diagnoses and included gender, age, gene mutation, and diagnosis (when comparing across diagnoses) as covariates. Results: Of the 412 patients, 284 (69%) were male, 128 (31%) were female, and the average age was 75 years. The five most common diagnoses, in descending order, were CMML (41%), AML-Others (23%), MDS (12%), AML-CMML (9%), and MPN (6%). The ten most common additional mutated genes, in descending order, were ASXL1 (44%), RUNX1 (28%), CUX1 (13%), JAK2 (13%), CBL (11%), TP53 (10%), SETBP1 (9%), KRAS (9%), STAG2 (9%), and NRAS (9%). A comparison of the top 5 diagnoses and the top 10 additional gene mutations showed an association between diagnosis and gene mutation (chi2 = 131, 36 df, p=.000). A post hoc test showed CBL mutations were less frequent in patients with AML-Others (p=.029), STAG2 mutations were less common in CMML patients (p=.007), and STAG2 mutations were more frequent in patients with MDS (p=.000). Among all patients, RUNX1 mutation (HR=2.4, 95% CI [1.3, 4.4], p=.005), ASXL1 mutation (HR=2.3, 95% CI [1.3, 4.2], p=.005), and CBL mutation (HR=2.0, 95% CI [1.0, 3.8], p=.048) were associated with lower OS. Among patients diagnosed with CMML, KRAS mutation (HR=4.1, 95% CI [1.5, 11.3], p=.006) and ASXL1 mutation (HR=3.3, 95% CI [1.4, 8.3], p=.009]) were associated with lower OS. Among patients with low-grade myeloid diseases (CMML and MDS), ASXL1 mutation (HR=2.6, 95% CI [1.2, 5.9], p=.021) was associated with lower OS. For the five most frequently co-mutated genes ( ASXL1, RUNX1, CUX1, JAK2, and CBL), no difference in OS was found between patients with CMML vs MDS, or AML-CMML vs AML-Others. Conclusions: SRSF2 and TET2 co-mutations occurred in various myeloid diseases, including CMML, AML transformed from CMML, other types of AML, MDS, and MPN. RUNX1, ASXL1, and CBL, were commonly mutated and associated with lower OS compared to patients with only SRSF2 and TET2 mutations. When comparing OS for patients diagnosed with low-grade diseases (CMML or MDS), ASXL1 mutation was associated with an increased risk of death. No difference in OS was found between CMML vs MDS, or AML-CMML vs AML-Others when co-mutation with ASXL1, RUNX1, CUX1, JAK2, or CBL was present.

Classification of Philadelphia-Negative MPN As Low Risk and High Risk MPN Based on Peripheral Blood Values and Molecular Genetics Only

Background: Philadelphia-negative myeloproliferative neoplasms (Ph -MPN) are characterized by overproduction of differentiated hematopoietic cells mediated in the majority of cases by mutations in JAK2, MPL or CALR (MPN driver genes). Ph - MPN include polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF) and MPN, unclassifiable (MPN-U) which differ in clinical presentation, prognosis, fibrosis and leukemic transformation rate as well as therapeutic options. However, WHO based classification requires experienced pathologists, in particular to diagnose prefibrotic PMF as high risk MPN, and thus remains observer dependent. Aim: Observer independent classification of Ph - MPN solely based on molecular genetics and peripheral blood (PB) parameters. Patients and Methods: We analyzed 267 Ph - MPN cases diagnosed as ET (n=76), PV (n=74), PMF (n=68) or MPN-U (n=49) following the WHO4R classification including only patients with an MPN driver mutation (median age: 68 years [22-91]; female: 41%; median follow-up: 5 years). All samples were analyzed by cytomorphology and whole genome sequencing (median coverage 100x). Mutation status of 20 genes associated with myeloid malignancies were analyzed in detail. Results: Genomic landscape of the MPN cohort showed mutations in JAK2 in 222 (83%) (n=132: single mutation; n=90: either mutation and copy neutral loss of heterozygosity or mutation and 9p gain), in CALR in 36 (14%), and in MPL in 9 (3%) patients. The median number of mutations per patient was two (range: 1-6). Within the cohort, 141 patients (53%) harbored MPN driver mutations only, while in 126 (47%) one to 5 additional mutations were found. The most frequent additional mutations were ASXL1 (n=50), TET2 (n=49; thereof 15 biallelic), SRSF2 (n=26), DNMT3A (n=18), U2AF1 (n=11) and TP53 (n=9; thereof 3 biallelic). Regarding PB parameters, high WBC (≥11×10 9/ L) were detected in 127 patients (48%), high PLT (≥450×10 9/ L) in 116 (43%) and anemia (HB <♂12 or ♀11 g/dL) in 50 patients (19%). We then performed Cox regression analyses for overall survival (OS) including only genetic abnormalities and PB values. In univariate analyses, biallelic TET2 inactivation ( TET2bi: hazard ratio/HR: 3.789), RUNX1 (n=4; HR: 13.479), ASXL1 (HR: 1.886), SRSF2 (HR: 3.218) mutations as well as high PLT (HR: 0.440), high WBC (HR: 1.998) and PB blasts >1% (n=57; HR: 1.904) showed significant associations with OS (for all p<0.02), while no effect was observed for MPN driver mutations, DNMT3A and monoallelic TET2 mutations. In addition, anemia showed a trend towards poor prognosis (HR: 1.595; p=0.079). Following this, we determined high and low risk MPN. In the absence of thrombocytosis, high risk MPN was defined if any of the four following risk factors were present: i) mutation in ASXL1 or SRSF2 or RUNX1 or TET2bi, ii) PB blasts >1%, iii) high WBC or iv) anemia. In the presence of thrombocytosis, at least two of these risk factors were required (Figure 1). Survival analysis revealed a significantly worse median OS of high risk (n=137; 51%) compared to low risk MPN (n=130; 49%) (8 years vs. not reached; p<0.001). This proposed novel stratification reflected prognosis better than WHO entities (median OS: MPN-U: 7 years; MF: 8 years; PV/ ET not reached; overall p=0.001) (Figure 1A). All 76 ET cases (100%) and 44/74 PV cases (59%) were classified as low risk MPN, while 63/68 PMF cases (93%) and 44/49 MPN-U cases (90%) were classified as high risk MPN (Figure 1B). Within low risk and high risk MPN, no significant OS differences were observed between the WHO entities ( p=0.114 and p=0.355, respectively). Conclusions: JAK2-pathway mutated Ph - MPN can be categorized into low and high risk MPN based on molecular genetics and PB values only. The presence of these objectively assessable risk factors in a patient with ET or PV warrants for a profound reevaluation of bone marrow histology (eventually by a reference pathologist for MPN) and clinical course before a high risk MPN (including prefibrotic PMF) can be ruled out. Whether the predictive value of low risk MPN based on molecular genetics and PB values only could be sufficient to omit BM biopsy in selected patients, needs to be evaluated in further prospective studies.

Correlation of TCR Repertoire Diversity with Myeloid Gene Mutations in Chronic and Advanced Phase Myeloproliferative Neoplasms

Introduction: Myeloproliferative neoplasms (MPN) are characterized by a chronic phase (CP), with indolent clinical behavior and, in 10-30% of cases, progression to advanced phases (AP), with aggressive behavior and compromised prognosis. Numerous factors have been associated with progression to AP, including the acquisition of mutations in recurrently mutated myeloid genes (1,2). On the other hand, decreased diversity in the T-cell receptor (TCR) repertoire has been associated with worse prognosis in solid tumors. The purpose of this work is to study the correlation between the acquisition of mutations in myeloid genes and the diversity of the TCR repertoire in chronic and advanced myeloproliferative neoplasms. Methods: Patients with chronic CP and AP myeloproliferative neoplasms were selected. The selected patients underwent an NGS panel of 48 myeloid genes. Only pathogenic (P) or likely pathogenic (LP) variants were considered. In parallel, the study of the TCR repertoire by NGS with the panel “AmpliSeq for Illumina Immune Repertoire Plus, TCR beta Panel” (Illumina™) was performed on the available samples. Finally, the obtained data were correlated. The study was approved by the local ethics committee. Results: A total of 22 patients were selected, 10 in CP and 12 in AP. Regarding diagnosis, 8 were polycythemia vera (PV), 4 essential thrombocythemia (ET), 6 secondary myelofibrosis (MFS) (1 to PV and 5 to ET), 2 systemic mastocytosis (MS) and 1 primary myelofibrosis (MFP). Eighty percent were male and the mean age was 68 years. The AP patients were significantly older (74 vs. 62 years of age, p<0,001). Regarding the myeloid NGS panel result, 41 mutations were found in 19 patients. Fourteen percent of the patients had no mutation, 36% had an isolated driver mutation and 50% had additional mutations. Of these, 9% were in CP and 81% were in AP. The most recurrently mutated genes were JAK2 (45.4%), CALR (18.2%), ASXL1, IDH2, SRSF2, IDH2 (all 13.6%), MPL and KIT (both 9.1%). Regarding the results of the TCR repertoire, it was possible to perform the study in 11 patients, 4 in CP and 7 in AP. Only 6/11 had results of sufficient quality to allow analysis. Of these 6 patients, 3 were in CP and 3 in AP. As can be seen in Figure 1, the diversity of the TCR between CP patients and PC patients was different. Thus, while the pattern of diversity in the CP phase shows the expected distribution, the diversity in AP shows a characteristic pattern. Conclusions: APs of MPNs show an abnormal TCR diversity pattern. This pattern may be related to the acquisition of myeloid gene mutations in AP. To our knowledge, this is the first study demonstrating an alteration in TCR diversity in AP and opens the door to future fields of research.

Bcor Truncation Mutations Collaborate with a U2AF1 S34F Mutant to Promote Clonal Hematopoiesis and MDS

Mutations in spliceosome genes such as U2AF1 have been identified across major cancer types, including myelodysplastic syndromes (MDS) and acute myeloid leukemia (AML). Mutations involving the U2AF1 gene, mostly commonly involving amino acids 34 or 157 have been reported in up to 20% of patients with MDS. To investigate how mutant U2AF1 contribute to hematologic malignancy, we generated transgenic mice that expressed a mutant U2AF1 S34F mutant under control of hematopoietic specific Vav1 regulatory elements. Sanger sequencing demonstrated that expression of the mutant U2AF1 was similar to that of wild-type (WT) U2AF1 in bone marrow and spleen. U2AF1 S34F mice showed decreased long-term hematopoietic stem cells (HSC) compared with age matched wild type WT mice. Hematopoietic stem cell transplantation (HSCT) showed that U2AF1 S34F HSCs repopulated recipients less efficiently than WT HSCs, consistent with previous reports. However, U2AF1 S34F mice did not develop evidence of hematologic malignancy, suggesting that additional mutations were required to develop MDS or AML. BCOR, a corepressor for BCL6, has been reported to be frequently co-mutated in MDS patients with U2AF1 S34F, suggesting that these two mutations might collaborate to produce MDS. To test the hypothesis, we introduced a BCOR truncation mutation into hematopoietic stem and progenitor cells (HSPC) from U2AF1 S34F or WT mice, using CRISPR-Cas9, followed by transplant to WT recipient mice. Primary recipients of U2AF1 S34F and Bcor double mutant bone marrow (U2B) showed decreased engraftment compared to WT-Bcor mutant (WB) recipients, consistent with a competitive disadvantage of U2AF1 S34F HSPC observed previously by several labs. We performed secondary HSCT to evaluate the long-term repopulation pattern of U2B HSPC. Secondary transplant recipients from U2B primary mice showed anemia and leukopenia, consistent with MDS. U2B secondary recipients typically showed low engraftment initially (reflecting ineffective hematopoiesis) followed by gradually increasing proportion of U2B cells in the peripheral blood. At necropsy, all secondary recipients of U2B bone marrow showed evidence of clonal hematopoiesis involving cells with 1 or 2 distinct, unique Bcor truncation mutations. We then sequenced bone marrow DNA from the U2B mouse used as donor for the secondary transplant and identified 14 independent Bcor mutations. All 14 Bcor mutations were out of frame, and encoded a truncated Bcor protein, indicating that cells with a U2AF1 S34F and a Bcor truncation had a competitive advantage in vivo. These results suggest that loss of normal Bcor function can collaborate with a U2AF1 S34F mutant, resulting in clonal expansion of abnormal HSC.

Signaling Pathway Gene Set Enrichment Analysis in Whole Exome Sequencing Data from Discordant Identical Twins Unveils Relevant Pathways As a Clue to Understand Somatic Mutation Acquisition and Clonal Evolution in Myeloproliferative Neoplasms

Although the role of classic driver mutations (i.e., JAK2, MPL, and CALR) in myeloproliferative neoplasm (MPN) development is well characterized, additional somatic mutations likely modulate the phenotype. Recurrent somatic mutations, such as those in TET2, DNMT3A, ASXL1 genes are commonly identified in MPN using targeted myeloid panels, however identification of somatic mutations using an unbiased approach may unveil novel pathways involved in MPN pathogenesis. We performed whole exome sequencing of blood samples of three sets of discordant identical twins in which one twin has MPN and the other twin is unaffected. The twin sets included all MPN subtypes (1 polycythemia vera, 1 essential thrombocythemia, 1 primary myelofibrosis). We also performed whole exome sequencing on additional family members, including the mother and father of the PV twin and the brother of the ET twin. Sequencing information from the discordant identical twins is a unique opportunity to identify somatic mutations in the affected twin that may contribute to MPN pathogenesis, and also to potentially identify clonal hematopoiesis in the unaffected twin. We mapped all the identified genetic variants to the affected genes, and we filtered all the genes mapped to those variants depending on whether they were present either in the MPN-affected twin or in the unaffected counterpart for further gene set enrichment pathway analysis. The gene set enriched signaling pathways from identified genetic variants for each condition-exclusive (either MPN or unaffected twin) allows us to identify and prioritize key pathways in MPN development in terms of somatic mutations acquisition. Furthermore, besides performing the analysis within each single MPN set, we analyzed the gene sets resulting from combining the different families allowing us not only to identify pathways at each single MPN type level but also among the different MPN diseases (PV, ET, and MF). We divided all the enrichment analyses into coding and silent variants to obtain a higher degree of pathway refinement. In single discordant twin sets we identified several pathways that may play an important role within MPN pathogenesis such as defective mismatch DNA repair, facilitated mitotic progression, extracellular matrix degradation, MAPK signaling, FGFR signaling, O-glycosylation of proteins, collagen metabolism and laminin interactions, neutrophil degranulation, interleukin-33 signaling, Rho GTPases and cGMP regulation, and nuclear pore complex (NPC) assembly. Interestingly, only when we analyze all the MPN-types together all the statistically significant pathways resulting from coding variants correspond only to DNA repair, specifically defective mismatch repair (PMS2, MLH1, MutSα, MutSβ, and TP53). Our findings reveal that DNA repair genes might occupy a central role within MPN acquisition and development, whereas at the same time each single MPN clinical entity might possess its own distinct mechanisms differentiating each one from the others.

Real-World Validation of the European Leukemia Network 2022 Risk Stratification in Acute Myelogenous Leukemia

Background: The 2017 European LeukemiaNet (ELN 2017) guidelines have become foundational for the risk stratification, prognostication, and treatment of acute myelogenous leukemia (AML). The updated 2022 European LeukemiaNet (ELN 2022) guidelines include additional cytogenetic abnormalities and genetic mutations for risk group assignment. It remains unknown how these updated guidelines compare for risk stratification and prognosis. Methods: We studied (N=287) adults with newly diagnosed AML from MedStar Georgetown University, MedStar Washington Hospital Center, and Baylor University Medical Center from 2012 to June 2023. Patients were stratified as favorable (fav), intermediate (int), or adverse (adv) risk according to ELN 2017 and ELN 2022 criteria. Overall survival (OS) was compared by age, race, and sex. Statistical analysis performed with SAS. Results: Median age was 65+16 years with a predominance of males (N=168, 59%). African-Americans (AA) composed 15% (N=44) of the cohort. Myelodysplastic-related mutations were present in 33 patients (15%), whereas the prevalence of epigenetic mutations was 25% (N=55). By ELN 2017 criteria, 19 (7%) patients were characterized as fav, 64 (23%) as int, and 198 (70%) as adv risk. Using ELN 2022 criteria, 18 (6%) patients were categorized as fav, 52 (19%) as int, and 211 (75%) as adv risk. Kaplan-Meier (KM) curves revealed a median overall survival of 200 days (d), 400 d, and 1532 d in the adv, int, and fav risk groups, respectively (log-rank p<0.001) by ELN 2017 criteria. Median OS was 379 d, 527 d, and 1552 d for the adv, int, and fav groups, respectively (log-rank p<0.001) in the ELN 2022 cohort. Stratifying by age <60 years, median OS was 390 d in the adv group and 832 d in the int group (log-rank p=.021)by ELN 2017 criteria,as compared to 350 d in the adv group and 757 d in the int group (log-rank p=.0012) by ELN 2022 criteria.Among those >60 years of age, median OS was 244 d and 349 d in the adv and int groups, respectively by ELN 2017 criteria (Anova p<0.25). In the ELN 2022 cohort, median OS among those >60 years of age was 284 d for the adv group and 209 days in the int group (Anova p<0.62). Among females, median OS in the adv group was 224 d and 342 d in the int group by ELN 2017 criteria (Anova p=0.4). In the ELN 2022 cohort, median OS among females was 214 d in the adv group and 421 d in the int group (Anova p=.13). Median OS among male patients in the ELN 2017 cohort was 324 d for those of adv risk and 623 d for those of int risk (Anova p<0.004). In the ELN 2022 cohort, median OS in males was 352 d and 563 d in the adv and int groups, respectively (Anova p<0.07) . In the ELN 2017 cohort, median OS was 259 d in AA patients as compared to 719 d in non-AA patients; this was not statistically significant (Anova p=0.16). Comparatively, in the ELN 2022 cohort, median OS for the AA patients was 153 d as compared to 212 d for the non-AA patient population (Anova p=0.86) .Conclusions: In this real-world dataset, the updated ELN 2022 guidelines reproduce differential survival for proposed favorable, intermediate, and adverse risk categories. When considering time to endpoint survival [Kaplan Meier curves] in our study, ELN 2022 seems to lack the ability to clearly discriminate among the adverse and intermediate risk subgroups. It is possible that patients seen in academic institutions not participating in FLT3 directed therapy trials retained inferior survival whereas similar patients fared better through early enrollment in trials using molecular targeted therapy. Finally, neither ELN 2017 nor ELN 2022 discriminate survival in AA populations for either adverse or intermediate subgroups. Efforts should be directed to develop novel risk stratification schemas to better encapsulate this vulnerable population.