Acid Cycle Research Articles

Systematic analysis of the effects of different nitrogen source and ICDH knockout on glycolate synthesis in Escherichia coli

BackgroundGlycolate is an important α-hydroxy carboxylic acid widely used in industrial and consumer applications. The production of glycolate from glucose in Escherichia coli is generally carried out by glycolysis and glyoxylate shunt pathways, followed by reduction to glycolate. Glycolate accumulation was significantly affected by nitrogen sources and isocitrate dehydrogenase (ICDH), which influenced carbon flux distribution between the tricarboxylic acid (TCA) cycle and the glyoxylate shunt, however, the mechanism was unclear.ResultsHerein, we used RNA-Seq to explore the effects of nitrogen sources and ICDH knockout on glycolate production. The Mgly534 strain and the Mgly624 strain (with the ICDH deletion in Mgly534), displaying different phenotypes on organic nitrogen sources, were also adopted for the exploration. Though the growth of Mgly534 was improved on organic nitrogen sources, glycolate production decreased and acetate accumulated, while Mgly624 achieved a balance between cell growth and glycolate production, reaching 0.81 g glycolate/OD (2.6-fold higher than Mgly534). To further study Mgly624, the significant changed genes related to N-regulation, oxidative stress response and iron transport were analyzed. Glutamate and serine were found to increase the biomass and productivity respectively. Meanwhile, overexpressing the arginine transport gene argT accelerated the cell growth rate and increased the biomass. Further, the presence of Fe2+ also speeded up the cells growth and compensated for the lack of reducing equivalents.ConclusionOur studies identified that ICDH knockout strain was more suitable for glycolate production. RNA-Seq provided a better understanding of the ICDH knockout on cellular physiology and glycolate production.

Metabolic Adaptation Drives <i>Staphylococcus aureus</i> Colonization and Infection of the Skin

Staphylococcus aureus is the most common cause of skin and soft tissue infection, yet the genetic changes in these organisms associated with adapation to human skin are not well characterized. Using S. aureus strains isolated from patients with atopic dermatitis (AD) we demonstrate that polymorphisms in metabolic genes, particularly those involved in the tricarboxylic acid (TCA) cycle, the fumarate/succinate axis, and the generation of terminal electron transporters are unexpectedly common. These AD strains activated glycolysis, HIF-α, and IL-1β and IL-18 release from keratinocytes and promoted dermatopathology equivalent to an MRSA USA300 control in a murine model of infection. However, in contrast to USA300, a typical AD isolate failed to generate protection from a secondary infectious challenge. Within the context of human skin, there is selection for S. aureus metabolic adaptive changes that both promote glycolysis and maintain pathogenicity.

A comparative transcriptome analysis of the novel obligate methanotroph Methylomonas sp. DH-1 reveals key differences in transcriptional responses in C1 and secondary metabolite pathways during growth on methane and methanol

BackgroundMethanotrophs play an important role in biotechnological applications, with their ability to utilize single carbon (C1) feedstock such as methane and methanol to produce a range of high-value compounds. A newly isolated obligate methanotroph strain, Methylomonas sp. DH-1, became a platform strain for biotechnological applications because it has proven capable of producing chemicals, fuels, and secondary metabolites from methane and methanol. In this study, transcriptome analysis with RNA-seq was used to investigate the transcriptional change of Methylomonas sp. DH-1 on methane and methanol. This was done to improve knowledge about C1 assimilation and secondary metabolite pathways in this promising, but under-characterized, methane-bioconversion strain.ResultsWe integrated genomic and transcriptomic analysis of the newly isolated Methylomonas sp. DH-1 grown on methane and methanol. Detailed transcriptomic analysis indicated that (i) Methylomonas sp. DH-1 possesses the ribulose monophosphate (RuMP) cycle and the Embden–Meyerhof–Parnas (EMP) pathway, which can serve as main pathways for C1 assimilation, (ii) the existence and the expression of a complete serine cycle and a complete tricarboxylic acid (TCA) cycle might contribute to methane conversion and energy production, and (iii) the highly active endogenous plasmid pDH1 may code for essential metabolic processes. Comparative transcriptomic analysis on methane and methanol as a sole carbon source revealed different transcriptional responses of Methylomonas sp. DH-1, especially in C1 assimilation, secondary metabolite pathways, and oxidative stress. Especially, these results suggest a shift of central metabolism when substrate changed from methane to methanol in which formaldehyde oxidation pathway and serine cycle carried more flux to produce acetyl-coA and NADH. Meanwhile, downregulation of TCA cycle when grown on methanol may suggest a shift of its main function is to provide de novo biosynthesis, but not produce NADH.ConclusionsThis study provides insights into the transcriptomic profile of Methylomonas sp. DH-1 grown on major carbon sources for C1 assimilation, providing in-depth knowledge on the metabolic pathways of this strain. These observations and analyses can contribute to future metabolic engineering with the newly isolated, yet under-characterized, Methylomonas sp. DH-1 to enhance its biochemical application in relevant industries.

Antillatoxin (ATX) Time–Resolved Absorption and Resonance FT–IR and Raman Biospectroscopy and Density Functional Theory (DFT) Investigation of Vibronic–Mode Coupling Structure

Antillatoxin (ATX) is a potent lipopeptide neurotoxin produced by the marine cyanobacterium Lyngbya majuscula. ATX activates voltage–gated sodium channels, which can cause cell depolarisation, NMDA–receptor over activity, excess calcium influx and neuronal necrosis. Parameters such as FT–IR and Raman vibrational wavelengths and intensities for single crystal Antillatoxin are calculated using density functional theory and were compared with empirical results. The investigation about vibrational spectrum of cycle dimers in crystal with carboxyl groups from each molecule of acid was shown that it leads to create Hydrogen bonds for adjacent molecules. The current study aimed to investigate the possibility of simulating the empirical values. Analysis of vibrational spectrum of Antillatoxin is performed based on theoretical simulation and FT–IR empirical spectrum and Raman empirical spectrum using density functional theory in levels of HF/6–31G*, HF/6–31++G**, MP2/6–31G, MP2/6–31++G**, BLYP/6–31G, BLYP/6–31++G**, B3LYP/6–31G and B3LYP6–31–HEG**. Vibration modes of methylene, carboxyl acid and phenyl cycle are separately investigated. The obtained values confirm high accuracy and validity of results obtained from calculations.

161 Dichloroacetate influences the mitochondrial activity of bovine oocytes impairing meiotic progression

Pyruvate is a key energy substrate for the oocyte during maturation and acquisition of developmental competence. Mitochondrial activity is also essential for oocyte competence. Dichloroacetate (DCA) is an inhibitor of pyruvate dehydrogenase kinase that indirectly stimulates pyruvate dehydrogenase (PDH), increasing pyruvate oxidation. PDH converts pyruvate into acetyl coenzyme A (acetyl-CoA) and thereby modulates the entry of glucose-derived carbons into the tricarboxylic acid (TCA) cycle, the main ATP production pathway within the oocyte. It was reported that DCA addition to embryo culture media improves embryo development in aged mice, by enhancing mitochondrial membrane potential (MMP) and decreasing oxidative stress (McPherson et al. 2014 Fertil. Steril. 101, 1458-1466). We hypothesised that increased pyruvate metabolism through the oxidative pathway, by stimulating PDH activity with DCA, could influence in vitro oocyte maturation. The aim of this work was to evaluate the effect of different concentrations of DCA during in vitro maturation (IVM) of bovine oocytes on maturation rate and mitochondrial activity, by assessing MMP and levels of flavin adenine dinucleotide (FADH2), nicotinamide adenine dinucleotide hydride (NADH), and reactive oxygen species (ROS). Abattoir-derived bovine cumulus-oocytes complexes (COC; n=360, over 4 replicates) were in vitro-matured with 0 (Control; n=120), 0.5mM (n=120) and 5mM (n=120) of DCA. After maturation, all matured COC were denuded by mechanical pipetting and meiotic progression was assessed by Hoechst 33342 staining and MMP by MitoTracker Red CMXRos test (Thermo Fisher Scientific, Waltham, MA, USA). Moreover, FADH2 and NADH levels were evaluated by autofluorescence (Dumollard et al. Development 134, 455-465) and ROS levels by CellRox® Green test (Thermo Fisher Scientific). Data were analysed by ANOVA, and the Tukey post hoc test was used to evaluate the difference among groups. The α-level was set at 0.05. Treatment with both concentrations of DCA decreased maturation rate (86.1, 67.8, and 67.6% in 0, 0.5, and 5mM groups, respectively; P<0.05). The MMP increased in oocytes matured with the highest concentration of DCA (3.42±0.28, 4.44±0.51, and 6.32±0.89 pixel/mm2, with 0, 0.5, and 5mM DCA, respectively; P<0.05). In line with this, higher levels of FADH2 (3.16±0.15, 3.96±0.24, and 3.83±0.20 pixel/mm2, with 0, 0.5, and 5mM DCA, respectively; P<0.05) and NADH (3.86±0.14, 4.80±0.16, and 4.95±0.17 pixel/mm2, with 0, 0.5, and 5mM DCA, respectively; P<0.05) were found in both DCA-treated groups compared with the control. Unexpectedly, ROS levels increased in the presence of DCA (0.9±0.07, 1.30±0.12, and 1.54±0.16 pixel/mm2, with 0, 0.5, and 5mM DCA, respectively; P<0.05) compared with the control. These results suggest that DCA was effective in stimulating mitochondrial activity of bovine oocytes, but also resulting in increased oxidative stress that likely accounts for the decreased maturation rate. Therefore, alternative strategies should be identified for the manipulation of the oocyte metabolic profile to improve oocyte developmental competence.

Study on the bio-function of lipA gene in Aspergillus flavus.

Lipoic acid synthase (LipA) plays a role in lipoic acid synthesis and potentially affects the levels of acetyl-CoA, the critical precursor of tricarboxylic acid (TCA) cycle. Considering the potential effect of LipA on TCA cycle, whether the enzyme is involved in the growth and aflatoxin B1 (AFB1) biosynthesis, the significant events in Aspergillus flavus is yet known. The study was designed to explore the role of lipA gene in A. flavus, including growth rate, conidiation, sclerotia formation, and biosynthesis of AFB1. LipA coding lipoic acid synthetase was knocked out using homologous recombination. The role of lipA gene in A. flavus morphogenesis (including colony size, conidiation, and sclerotia formation) was explored on various media, and the bio-function of lipA gene in the biosynthesis of AFB1 was analyzed by thin layer chromatography analysis. The growth was suppressed in △lipA. The formation of conidia and sclerotia was also reduced when lipA gene was deleted. Moreover, AFB1 was down-regulated in ΔlipA compared with WT controls. LipA plays a role in the development of A. flavus and AFB1 biosynthesis, contributing to the full understanding of the lipA bio-function in A. flavus.

Comparative transcriptome analysis reveals that tricarboxylic acid cycle-related genes are associated with maize CMS-C fertility restoration

BackgroundC-type cytoplasmic male sterility (CMS-C) is one of the three major types of cytoplasmic male sterility (CMS) in maize. Rf4 is a dominant restorer gene for CMS-C and has great value in hybrid maize breeding, but little information concerning its functional mechanism is known.ResultsTo reveal the functional mechanism of Rf4, we developed a pair of maize near-isogenic lines (NILs) for the Rf4 locus, which included a NIL_rf4 male-sterile line and a NIL_Rf4 male fertility-restored line. Genetic analysis and molecular marker detection indicated that the male fertility of NIL_Rf4 was controlled by Rf4. Whole-genome sequencing demonstrated genomic differences between the two NILs was clustered in the Rf4 mapping region. Unmapped reads of NILs were further assembled to uncover Rf4 candidates. RNA-Seq was then performed for the developing anthers of the NILs to identify critical genes and pathways associated with fertility restoration. A total of 7125 differentially expressed genes (DEGs) were identified. These DEGs were significantly enriched in 242 Gene Ontology (GO) categories, wherein 100 DEGs were involved in pollen tube development, pollen tube growth, pollen development, and gametophyte development. Homology analysis revealed 198 male fertility-related DEGs, and pathway enrichment analysis revealed that 58 DEGs were enriched in cell energy metabolism processes involved in glycolysis, the pentose phosphate pathway, and pyruvate metabolism. By querying the Plant Reactome Pathway database, we found that 14 of the DEGs were involved in the mitochondrial tricarboxylic acid (TCA) cycle and that most of them belonged to the isocitrate dehydrogenase (IDH) and oxoglutarate dehydrogenase (OGDH) enzyme complexes. Transcriptome sequencing and real-time quantitative PCR (qPCR) showed that all the above TCA cycle-related genes were up-regulated in NIL_Rf4. The results of our subsequent enzyme-linked immunosorbent assay (ELISA) experiments pointed out that the contents of both the IDH and OGDH enzymes accumulated more in the spikelets of NIL_Rf4 than in those of NIL_rf4.ConclusionThe present research provides valuable genomic resources for deep insight into the molecular mechanism underlying CMS-C male fertility restoration. Importantly, our results indicated that genes involved in energy metabolism, especially some mitochondrial TCA cycle-related genes, were associated with maize CMS-C male fertility restoration.

Comparative proteomic analysis reveals the regulatory network of the veA gene during asexual and sexual spore development of Aspergillus cristatus.

Aspergillus cristatus is the predominant fungal population during fermentation of Chinese Fuzhuan brick tea, and belongs to the homothallic fungal group that undergoes a sexual stage without asexual conidiation under hypotonic conditions, while hypertonic medium induces initiation of the asexual stage and completely blocks sexual development. However, the veA deletion mutant only produces conidia in hypotonic medium after a 24-h culture, but both asexual and sexual spores are observed after 72 h. The veA gene is one of the key genes that positively regulates sexual and negatively regulates asexual development in A. cristatus. To elucidate the molecular mechanism of how VeA regulates asexual and sexual spore development in A. cristatus, 2D electrophoresis (2-DE) combined with MALDI-tandem ToF MS analysis were applied to identify 173 differentially expressed proteins (DEPs) by comparing the agamotype (24 h) and teleomorph (72 h) with wild-type (WT) A. cristatus strains. Further analysis revealed that the changed expression pattern of Pmk1-MAPK and Ser/Thr phosphatase signaling, heat shock protein (Hsp) 90 (HSP90), protein degradation associated, sulphur-containing amino acid biosynthesis associated, valine, leucine, isoleucine, and arginine biosynthesis involved, CYP450 and cytoskeletal formation associated proteins were involved in the production of conidia in agamotype of A. cristatus. Furthermore, the deletion of veA in A. cristatus resulted in disturbed process of transcription, translation, protein folding, amino acid metabolism, and secondary metabolism. The carbohydrate and energy metabolism were also greatly changed, which lied in the suppression of anabolism through pentose phosphate pathway (PPP) but promotion of catabolism through glycolysis and tricarboxylic acid (TCA) cycle. The energy compounds produced in the agamotype were mainly ATP and NADH, whereas they were NADPH and FAD in the teleomorph. These results will contribute to the existing knowledge on the complex role of VeA in the regulation of spore development in Aspergillus and provide a framework for functional investigations on the identified proteins.

Abstract LB-269: IDH2 inhibition enhances proteasome inhibitor responsiveness in hematological malignancies

Abstract The introduction of proteasome inhibitors (PIs) into the clinic has transformed the treatment of patients affected by multiple myeloma (MM) and mantle-cell lymphoma (MCL) establishing new standards of care. Despite these improvements, patients continuously relapse or are intrinsically resistant to PIs. Here, to identify druggable targets that synergize with PIs, we carried out a functional screening in MM cell lines using a short hairpin RNA library targeting 152 cancer driver genes, highly representative of all signaling pathways. The Isocitrate Dehydrogenase 2 (IDH2) gene was identified as a top candidate, showing a synthetic lethal activity with the PI Carfilzomib (CFZ). IDH2 is a NADP(+) dependent mitochondrial enzyme which catalyzes the oxidative decarboxylation of isocitrate to 2-oxoglutarate in the tricarboxylic acid (TCA) cycle. We demonstrated that combinations of the pharmacological IDH2 inhibitor AGI-6780 with FDA approved PIs significantly increased apoptotic cell death in ten MM cell lines, both sensitive and resistant to PIs. Combined treatments triggered synergistic cytotoxicity also in four MCL and in two Burkitt's lymphoma cell lines. Importantly, CFZ/AGI-6780 treatment increased death of primary CD138-positive cells from nine MM patients and exhibited a favorable cytotoxicity profile towards peripheral blood mononucleated cells and bone marrow-derived stromal cells. Mechanistically, CFZ/AGI-6780 combination significantly decreased TCA cycle activity and ATP levels, as a consequence of enhanced IDH2 enzymatic inhibition. In contrast, only a slight increase of mitochondrial reactive oxygen species (ROS) was observed. CFZ treatment reduced the expression of nicotinamide phosphoribosyltransferase (NAMPT), a rate-limiting enzyme required for IDH2 activation through the NAD(+)-dependent deacetylase SIRT3. Consistently, combination of CFZ with either NAMPT (FK866) or SIRT3 (AGK7) inhibitors impaired IDH2 activity and increased MM cell death, thus phenocopying CFZ/AGI-6780 effects and putting the proteasome in a direct link with IDH2 inhibition. Finally, inducible IDH2 knock-down enhanced the therapeutic efficacy of CFZ in a subcutaneous xenograft model of MM, resulting in inhibition of tumor progression and extended survival. In conclusion, our data demonstrate that IDH2 inhibition increases the therapeutic efficacy of PIs, thus providing compelling evidence for treatments with lower and less toxic doses, and broadening the application of PIs to other malignancies. Citation Format: Elisa Bergaggio, Chiara Riganti, Giulia Garaffo, Elisabetta Mereu, Nicoletta Vitale, Cecilia Bandini, Elisa Pellegrino, Paola Omedè, Katia Todoerti, Valentina Audrito, Antonio Rossi, Francesco Bertoni, Silvia Deaglio, Antonino Neri, Antonio Palumbo, Roberto Piva. IDH2 inhibition enhances proteasome inhibitor responsiveness in hematological malignancies [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr LB-269.

Abstract 5853: Targeting NAD+/PARP DNA repair pathway as a novel therapeutic approach to SDHB-mutated cluster I pheochromocytoma and paraganglioma

Abstract Background: Cluster I pheochromocytomas and paragangliomas (PCPGs) tend to develop malignant transformation, tumor recurrence, and multiplicity. Transcriptomic profiling suggests that cluster I PCPGs and other related tumors exhibit distinctive changes in the tricarboxylic acid (TCA) cycle, the hypoxia signaling pathway, mitochondrial electron transport chain, and methylation status, suggesting that therapeutic regimen might be optimized by targeting these signature molecular pathways. Experimental design: We investigated molecular signatures in clinical specimens from cluster I and II PCPGs, with a focus on the therapeutic resistance mechanisms. Further, we tested the applicability of a combination therapy including an FDA approved PARP inhibitor olaparib (Ola) and temozolomide (TMZ) in both in vitro cellular model and an in vivo allograft animal model. Results: Our findings showed that cluster I PCPGs develop a distinctive dependency on mitochondrial complex I, evidenced by the upregulation of complex I components and enhanced NADH dehydrogenation. Mechanistically, alteration in mitochondrial function resulted in strengthened NAD+ metabolism, which provides essential cofactor for PARP catalytic activity, prompting base excision repair and chemo resistance. Combining PARP inhibitor Ola with TMZ not only improved cytotoxicity but also reduced metastatic lesions, with prolonged overall survival in a mouse model with PCPG allograft. Conclusions: Our results suggest that the NAD+/PARP pathway is a crucial targetable therapeutic resistance mechanism in SDHB-mutated PCPG. Combination therapy using TMZ and Ola could become an effective strategy against these and other advanced cluster I tumors. Disclosure Statement: The authors have nothing to disclose. Citation Format: Ying Pang, Yanxin Lu, Veronika Caisova, Yang Liu, Petra Bullova, Thanh-Truc Huynh, Zdenek Frysak, Igor Hartmann, David Taïeb, Karel Pacak, Chunzhang Yang. Targeting NAD+/PARP DNA repair pathway as a novel therapeutic approach to SDHB-mutated cluster I pheochromocytoma and paraganglioma [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 5853.

Abstract 5486: The role of the GABA shunt in prostate cancer metabolic reprogramming and aggressive phenotype

Abstract The GABA (γ-aminobutyric acid) shunt, a bypass mechanism for a portion of the tricarboxylic acid (TCA) cycle, is responsible in the mammalian central nervous system for the synthesis and degradation of the inhibitory neurotransmitter GABA. Glutamic acid decarboxylase (GAD67 and GAD65; gene names GAD1 and GAD2, respectively) synthesizes GABA from glutamate, while GABA-transaminase (GABA-T; gene name ABAT) metabolizes GABA into succinic semialdehyde, which is dehydrogenated into succinate. Although poorly studied in mammals, the GABA shunt plays a protective role against pH, thermo-, and oxidative stresses in plants and bacteria. We hypothesize that both cell non-autonomous GABA from the tumor microenvironment (TME), and cell-autonomous production of GABA contribute to cancer progression. Cell types within the TME such as endothelial and T-cells, are known to secrete GABA. To investigate the utilization of cell non-autonomous GABA by prostate cancer cells, we determined via LC-MS/MS that although the prostate adenocarcinoma LNCaP cell line does not contain significant amounts of GABA, it is capable of taking up exogenous GABA. The effect of exogenous GABA treatment on the metabolic capacity of LNCaP cells was examined using the SEAhorse XF24 Bioanalyzer. GABA treatment increased oxygen consumption rate while decreasing the rate of glycolysis and glycolytic reserve. This effect was blocked by co-treatment with GABA-T inhibitors, suggesting the ability of GABA to increase mitochondrial respiration occurs through the GABA shunt. GABA treatment did not affect the metabolic phenotype of a normal epithelial cell line control. Regarding cell-autonomous production of GABA, recent studies show dysregulation of genes encoding GABA shunt enzymes in various cancers; specifically relevant to this study, GAD1 is upregulated in castration-resistant prostate cancer cell lines (Ippolito 2014). Consistent with the involvement of GAD1 in aggressive prostate cancers, our analysis of the TCGA Provisional prostate cancer dataset reveals that GAD1 mRNA expression level increases with increasing Gleason Score (Pearson r = 0.19; p < 0.00005). Additionally, analysis of the Beltran (2016) data set reveals that GAD1 transcripts are upregulated in treatment-induced neuroendocrine prostate cancer compared to prostate adenocarcinoma (unpaired t-test, p < 0.0005). We hypothesize that both cell non-autonomous and autonomous GABA play a role in cancer progression. Uptake of GABA from the TME may support metabolic reprogramming of primary tumor cells, while upregulation of GAD1 and subsequent increase in cell-autonomous GABA production may provide a malignant advantage to late-stage cancer. The GABA shunt may offer a novel therapeutic target for prostate cancer treatment by exploiting a poorly understood metabolic pathway linked to the TCA cycle. We thank the LSUHSC-S Feist-Weiller Cancer Center for financial support. Citation Format: Erika L. Knott, Sumitra Miriyala, Hyung Nam, Manikandan Panchatcharam, Nancy Leidenheimer. The role of the GABA shunt in prostate cancer metabolic reprogramming and aggressive phenotype [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 5486.

Abstract 4861: Initial preclinical evaluation of a novel inhibitor of mitochondrial metabolism against prostate cancer

Abstract CPI-613 is a novel inhibitor of mitochondrial metabolism that has recently shown promise in early stage clinical trials for pancreatic cancer, lymphoma, and leukemia. It is a lipoate analogue that selectively inhibits pyruvate dehydrogenase (PDH) and alpha-ketoglutarate dehydrogenase (KGDH) complexes in tumor cells (reviewed in Exp.Rev.Clin.Pharma. 7, 837). Since these two enzymes control the vast majority of carbon flow into the tricarboxylic acid (TCA) cycle, CPI-613 significantly inhibits mitochondrial metabolism. Importantly, it has demonstrated a favorable safety profile in clinical trials, presumably due to its documented selectivity to cancer metabolism. Early phase clinical trials with CPI-613 have demonstrated very promising clinical responses in pancreatic cancer, leukemia, and lymphoma when used in combination with standard chemotherapy. For example, in a recently published Phase I clinical trial in 18 patients with Stage 4 pancreatic cancer in combination with a modified FOLFIRINOX regiment, three (17%) had a complete response, eight (44%) had a partial response, three (17%) had stable disease, and four (22%) had progressive disease. Since altered cancer metabolism is a hallmark of cancer in general, we hypothesized that CPI-613 should have efficacy in other cancers, including prostate cancer, which is the second most common malignancy in men that affects over 160,000 men in the U.S annually. To test our hypothesis, we treated prostate cancer cell lines with CPI-613 in vitro and in vivo in a preclinical murine flank model. We found that CPI-613 was highly effective at killing prostate cancer cells in vitro, which was similar to its previously published potency in pancreatic cancer cells. Furthermore, we found in vitro therapeutic synergy with docotaxel, a standard of care treatment of advanced prostate cancer. We therefore tested CPI-613 in a preclinical Pc-3 flank model of androgen-resistant prostate cancer. Groups of mice (n=8) were treated 2-3 times per a week for 5 weeks with 2.5mg/kg of CPI-613, 10mg/kg of CPI-613 and control saline after tumors reached approximately 40mm3. CPI-613 was formulated in the same manner as it was for clinical trials. Both groups of mice treated with CPI-613 demonstrated a significant decrease in tumor growth without any toxicity. There was no observed difference between doses, which may be due to having crossed the threshold of drug uptake and concentration required in the mitochondria for a response. Furthermore, there was a significant increase in survival between treated groups and the control group, again without a dose effect. These results for the first time indicate biological activity of CPI-613 both in vitro and in vivo against prostate cancer and therefore warrants further investigation in representative preclinical prostate cancer models and in combination with standard-of-care therapies. Citation Format: Kiran K. Solingapuram Sai, Anirudh Sattiraju, Zuzana Zachar, Michael S. Dahan, Robert Shorr, Timothy S. Pardee, Paul M. Bingham, Akiva Mintz. Initial preclinical evaluation of a novel inhibitor of mitochondrial metabolism against prostate cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4861.

Abstract 2401: Effects of carcinoma-associated fibroblasts on cancer metabolism

Abstract Rationale: In previous studies, it has been found that cancer-associated fibroblasts (CAFs) interaction with carcinoma cells and helped cancer cell grow which contributed to cancer progression and aggressiveness. However, how CAFs helped cancer cells grow, specifically what nutrition CAFs provides to tumors has not yet been fully understood. Objectives: We are studying cancer metabolism to identify pathways to target for cancer therapy. Therefore, in this study, we sought to determine which key metabolites in glucose metabolism, specifically glycolysis and the tricarboxylic acid (TCA) cycle metabolites that CAFs feed cancer cells in order for pancreatic cancer cells (P198), to grow better. Measurement Methods and Main Results: We first assessed pancreatic cancer cell proliferation (P198 cells) with and without the presence of CAFs through the co-culture technique. We assessed P198 cell number after the co-culture. We found that P198 cells grew better when co-cultured with CAFs as compared to P198 that was grown alone. We next investigated which metabolites produced from the CAFs cells are feeding P198 cells. In order to determine which metabolites from glucose were provided from CAFs to P198 cells, we first grew CAFs in 13C6-labeled glucose, removed the labeling medium, then co-cultured P198 with CAFs. The collected metabolites were assessed using Agilent 6520 Quadrupole-Time-of-Flight (Q-TOF) mass spectrometer with Agilent 1260 HPLC and a 6490 triple-quadrupole (QQQ) mass spectrometer. Metabolites were identified by retention time using in-house compound standard databases. In parallel, metabolites were identified using MS/MS fragmentation data under identical conditions. Metabolic pathways were reconstructed and analyzed in three categories: bioenergetics, biosynthesis and redox homeostasis of glucose metabolism to study these metabolic pathways exchanged between CAF and P198. Metabolite peak intensities were normalized to the protein concentration and cell number. We observed an increase in intensities of metabolites in the TCA cycle and glycolysis in P198 after co-culture with CAFs. Conclusion: These data supports growth benefits of pancreatic cancer in the presence of CAFs. We also found evidence of the metabolic exchange between CAFs and pancreatic cancer cells, which potentially explains the growth benefit. Citation Format: Tu Nguyen, Jimmy Kirsch, Karim Nabi, Christos Sazeides, Addison Quinones, Jessica Tan, Marjorie Antonio, Felipe Camelo, Jin Jung, Anne Le. Effects of carcinoma-associated fibroblasts on cancer metabolism [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 2401.

Abstract 4962: Metabolic rewiring of macrophages by CpG stimulates anti-tumor activity that overrides CD47-resistance in pancreatic cancer

Abstract Although macrophages commonly support cancer growth, they can be induced with anti-tumor functions - such as the ability to phagocytose and kill tumor cells. This activity is governed by stimulatory as well as inhibitory signals (e.g. CD47). The role of central carbon metabolism in determining macrophage function, however, remains poorly understood. Here, we identify CpG-activated changes in the metabolism of macrophages to be a major determinant of their phagocytic and anti-tumor capabilities, including the ability to overcome inhibitory CD47 expressed by tumor cells. In a fully syngeneic model of murine pancreatic ductal adenocarcinoma (PDAC), systemic delivery of CpG re-directed macrophages to mediate anti-tumor activity against PDAC tumor cells independent of CD47 expressed by tumor cells. The anti-tumor potential stimulated by CpG was not associated with polarization of macrophages toward classical M1 or M2 phenotypes, but rather was dependent on a hybrid state of metabolic features found in M1 and M2 macrophages. These metabolic changes required shunting of tricarboxylic acid (TCA) cycle intermediates for de novo biosynthesis of lipids and elevated fatty acid oxidation (FAO) that was supported by glutamine anaplerosis. Coordination of these processes by carnitine palmitoyltransferase 1A (CPT1A) and ATP citrate lyase (ACLY) supported the ability of macrophages to bypass the CD47 inhibitory pathway and mediate anti-tumor functions. Our findings underscore a novel role for the metabolic state of macrophages in overriding barriers to anti-tumor activity, and reveal potential targets that may enhance CD47-based therapies. Citation Format: Mingen Liu, Roddy S. O'Connor, Sophie Trefely, Nathaniel W. Snyder, Gregory L. Beatty. Metabolic rewiring of macrophages by CpG stimulates anti-tumor activity that overrides CD47-resistance in pancreatic cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 4962.

Abstract 1335: Withaferin A induces nonprotective autophagy in a STK11-independent manner and mediates breast cancer inhibition via energetic impairment

Abstract Background and Aim: Cancer cells undergo cytoprotective autophagy and evade chemotherapy therefore many clinical trials are investigating the efficacy of autophagy inhibition in combination with chemotherapy. At the functional level, autophagic process can be cytoprotective, cytotoxic, cytostatic or nonprotective. We investigated strategies to convert cellular autophagic response to non-protective autophagy which does not interfere with therapeutic regimens exploiting bioactive molecules. Methods: Utilizing in vivo xenograft models, we established that Withaferin A (WA), a bioactive molecule from Withania Somnifera inhibits breast tumorigenesis. Autophagy studies were conducted utilizing immunoblot, RT-PCR, and immunofluorescence analyses for autophagy markers, transmission electron microscopy and confocal imaging. The fusion of autophagosome and lysosome was examined by using GFP-LC3/LysoTracker-red and GFP-LC3/mCherryRAB7A. Protein degradation activity of lysosomes and ATP levels were examined by DQ-BSA assay, Cathepsin activity and quantitative ATP assay. Results: WA inhibited growth and induced apoptosis in breast cancer cells resulting in inhibition of breast carcinogenesis in vivo. Although WA increased tumor suppressor LKB1 which is known to be involved in autophagy, WA-mediated increased cleavage of Light Chain 3 type II (LC3-II) and punctated LC3-II staining was LKB1-independent. The redistribution of EGFP-LC3 from cytosol to autophagosome indicated increased formation of autophagosomes in WA-treated cells. However, WA-induced increased autophagosome-formation was not mediated by increased activation of autophagy by upstream processes but was due to blockade of lysosomal-degradation as evident by higher level of sequestosome 1 (SQSTM1/p62) and decreased turnover of LC3. WA was found to be a potent lysosomal deacidification agent capable of blocking autophagic flux. Accordingly, inhibiting autophagy by blocking formation of autophagosomes or elevating lysosomal pH did not interfere with WA-mediated growth-inhibition. WA blocked autophagic flux decreasing recycling of cellular fuels leading to reduced energy supply. Investigating this alternative mechanism, we discovered that indeed, WA reduced ATP levels and increased phosphorylation of AMP-activated protein kinase (AMPK). Modulating substrates for tricarboxylic acid (TCA) cycle with methyl pyruvate protected WA-treated cells while 2DG potentiated WA-induced cell death. Conclusion: Our results indicate that WA induces a non-protective autophagy and blocks energy fuels in cancer cells by reducing ATP levels and inhibiting lysosomal acidification hence offering a three-pronged approach to facilitate cancer cell death. WA might be a useful strategic addition to chemotherapy regimens to evade cytoprotective effects of autophagy. Citation Format: Nethaji Muniraj, Arumugam Nagalingam, Neeraj K. Saxena, Dipali Sharma. Withaferin A induces nonprotective autophagy in a STK11-independent manner and mediates breast cancer inhibition via energetic impairment [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 1335.

Proteome Analysis Implicates Adaptive Changes in Metabolism and Body Wall Musculature of Caenorhabditis elegans Dauer Larva

Dauer larva is an alternative developmental stage of Caenorhabditis elegans ( C. elegans ) that occurs when the environmental condition is unfavorable for growth. Little is known regarding how the proteome of dauer larvae respond to poor environmental growth conditions. Such knowledge is expected to help understand the survival mechanism(s) of dauer larvae. In order to uncover the proteome differences between dauer larvae and normally developed third stage larvae (L3), an L2 stage larvae was starved to create the dauer larvae and this proteome was compared with that of the L3 larvae. Results showed that proteins involved in muscle assembly and fatty acid oxidation are increased in dauer larvae, while proteins involved in maintaining regular organismic activity such as reproduction, translation and apoptotic processes are decreased. The protein expression profile also suggested that the glyoxylate cycle is preferentially utilized during dauer arrest over the tricarboxylic acid (TCA) cycle and significant structural rearrangement occurs on the hypodermis, body wall musculature, and pharynx.

Effects of NAFLD on Acetyl-CoA Partitioning and Ketone Kinetics in Response to a 24-Hour Fast

During an overnight fast (12 hour), the liver provides glucose as fuel for other tissues via glycogenolysis and the energetically expensive process of gluconeogenesis. During this period, energy to support this process is generated primarily by the tricarboxylic acid (TCA) cycle. As the duration of fasting prolongs, and glycogen stores are depleted (>24 hour), the liver shifts to the production of ketone bodies that can be used as a secondary fuel source by peripheral tissues. In healthy humans, this period of fasting is generally associated with increased β-oxidation and partitioning of acetyl-CoA away from the TCA cycle and toward ketone body production. We have previously shown that subjects with nonalcoholic fatty liver disease (NAFLD) have increased rates of acetyl-CoA oxidation in the TCA cycle after a 12 hour fast. To examine how NAFLD affects hepatic response to a 24 hour fast, we infused stable isotope tracers into BMI and age matched subjects with (n=12) and without (n=12) NAFLD. At enrollment, NAFLD subjects had greater liver triglycerides (P<0.05) and hepatic insulin resistance (P<0.05), as well as higher fasting plasma concentrations of cholesterol, triglycerides, and glucose (P<0.05). After fasting for 24 hours, subjects with NAFLD failed to suppress endogenous glucose production as compared to controls. This was associated with a higher ratio of plasma insulin to glucagon as well as a blunted increase in the concentration of plasma free fatty acids as fasting duration prolonged. As previously shown in overnight fasted subjects, TCA cycle activity was significantly higher in NAFLD subjects after a 24 hour fast. However, despite elevated TCA cycle flux, NAFLD subjects failed to increase overall β-oxidation compared to controls due to reduced utilization of acetyl-CoA for ketone synthesis. In conclusion, after a 24 hour fast, the liver of NAFLD subjects produced more glucose and disposed of less fat via β-oxidization by shuttling more acetyl-CoA to the TCA cycle but much less to ketogenesis. Disclosure J.A. Fletcher: None. S. Deja: None. S.C. Burgess: None. J. Browning: None.

Effect of Bulk MoS₂ on the Metabolic Profile of Yeast.

MoS2, a kind of two-dimensional material with unique performances, has been widely used in many fields. However, an in-depth understanding of its toxicity is still needed, let alone its effects on the environmental microorganism. Herein, we used different methods, including metabolomics technology, to investigate the influence of bulk MoS2 (BMS) on yeast cells. The results indicated that high concentrations (1 mg/L and more) of BMS could destroy cell membrane and induce ROS accumulation. When exposed to a low concentration of BMS (0.1 mg/L), the intracellular concentrations of many metabolites (e.g., fumaric acid, lysine) increased. However, most of their concentrations descended significantly as the yeast cells were treated with BMS of high concentrations (1 mg/L and more). Metabolomics analysis further revealed that exposure to high concentrations of BMS could significantly affect some metabolic pathways such as amino acid and citrate cycle related metabolism. These findings will be beneficial for MoS2 toxicity assessment and further applications.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Metabolomic studies identify changes in transmethylation and polyamine metabolism in a brain-specific mouse model of tuberous sclerosis complex.

Tuberous sclerosis complex (TSC) is an autosomal dominant neurodevelopmental disorder and the quintessential disorder of mechanistic Target of Rapamycin Complex 1 (mTORC1) dysregulation. Loss of either causative gene, TSC1 or TSC2, leads to constitutive mTORC1 kinase activation and a pathologically anabolic state of macromolecular biosynthesis. Little is known about the organ-specific metabolic reprogramming that occurs in TSC-affected organs. Using a mouse model of TSC in which Tsc2 is disrupted in radial glial precursors and their neuronal and glial descendants, we performed an unbiased metabolomic analysis of hippocampi to identify Tsc2-dependent metabolic changes. Significant metabolic reprogramming was found in well-established pathways associated with mTORC1 activation, including redox homeostasis, glutamine/tricarboxylic acid cycle, pentose and nucleotide metabolism. Changes in two novel pathways were identified: transmethylation and polyamine metabolism. Changes in transmethylation included reduced methionine, cystathionine, S-adenosylmethionine (SAM-the major methyl donor), reduced SAM/S-adenosylhomocysteine ratio (cellular methylation potential), and elevated betaine, an alternative methyl donor. These changes were associated with alterations in SAM-dependent methylation pathways and expression of the enzymes methionine adenosyltransferase 2A and cystathionine beta synthase. We also found increased levels of the polyamine putrescine due to increased activity of ornithine decarboxylase, the rate-determining enzyme in polyamine synthesis. Treatment of Tsc2+/- mice with the ornithine decarboxylase inhibitor α-difluoromethylornithine, to reduce putrescine synthesis dose-dependently reduced hippocampal astrogliosis. These data establish roles for SAM-dependent methylation reactions and polyamine metabolism in TSC neuropathology. Importantly, both pathways are amenable to nutritional or pharmacologic therapy.