30-kDa Subunit Research Articles

Aging Related Changes in Smooth Muscle Contractile and Regulatory Proteins

Aging is a significant risk factor for cardiovascular disease and is known to be associated with an increase in vascular stiffness and decrease in sensitivity to NO mediated vasodilatation. However, the underlying mechanism for these changes in vascular function is unknown. Smooth muscle tone is known to be regulated by the expression and phosphorylation of both nonmuscle (NM) and smooth muscle (SM) myosin. NM and SM phosphorylation is regulated by the activity of myosin light chain kinase (MLCK) and MLC phosphatase. MLC phosphatase is a trimeric enzyme consisting of enzymatic, myosin targeting (MYPT1) and a 20kDa subunit of unknown function. Two isoforms of MYPT1 are produced by alternative mRNA splicing, which differ by the presence or absence of a COOH-terminal leucine zipper (LZ+/-), and the relative expression of LZ+/LZ- MYPT1 determines the sensitivity to NO mediated vasodilatation. We defined NM myosin expression using two-dimensional SDS PAGE and LZ+/LZ- MYPT1 expression using immunoblotting in aortic and tertiary mesenteric smooth muscle from 6mo and 24mo old Fischer344 rats. The data demonstrate that aging is associated with a significant decrease in the expression of both LZ+ MYPT1 and NM myosin. The reduction in LZ+ MYPT1 expression would both decrease the sensitivity to NO mediated smooth muscle dilatation and increase vascular tone, which is a hallmark of the vasculature in aging. On the other hand, the reduction in NM myosin would result in a decrease in vascular tone and could represent a compensatory mechanism to normalize blood pressure during aging. These data demonstrate that there are changes in the expression of smooth muscle regulatory and contractile proteins during aging and these changes in protein expression contribute to molecular mechanism for the decrease in sensitivity to NO mediated vasodilatation as well as the increase in vascular tone or the vascular dysfunction that occurs with aging. Supported by a Mayo CV Prospective Grant (FVB). This is the full abstract presented at the American Physiology Summit 2024 meeting and is only available in HTML format. There are no additional versions or additional content available for this abstract. Physiology was not involved in the peer review process.

Aging related decreases in NM myosin expression and contractility in a resistance vessel.

Introduction: Vasodilatation in response to NO is a fundamental response of the vasculature, and during aging, the vasculature is characterized by an increase in stiffness and decrease in sensitivity to NO mediated vasodilatation. Vascular tone is regulated by the activation of smooth muscle and nonmuscle (NM) myosin, which are regulated by the activities of myosin light chain kinase (MLCK) and MLC phosphatase. MLC phosphatase is a trimeric enzyme with a catalytic subunit, myosin targeting subunit (MYPT1) and 20kDa subunit of unknown function. Alternative mRNA splicing produces LZ+/LZ- MYPT1 isoforms and the relative expression of LZ+/LZ- MYPT1 determines the sensitivity to NO mediated vasodilatation. This study tested the hypothesis that aging is associated with changes in LZ+ MYPT1 and NM myosin expression, which alter vascular reactivity. Methods: We determined MYPT1 and NM myosin expression, force and the sensitivity of both endothelial dependent and endothelial independent relaxation in tertiary mesenteric arteries of young (6mo) and elderly (24mo) Fischer344 rats. Results: The data demonstrate that aging is associated with a decrease in both the expression of NM myosin and force, but LZ+ MYPT expression and the sensitivity to both endothelial dependent and independent vasodilatation did not change. Further, smooth muscle cell hypertrophy increases the thickness of the medial layer of smooth muscle with aging. Discussion: The reduction of NM myosin may represent an aging associated compensatory mechanism to normalize the stiffness of resistance vessels in response to the increase in media thickness observed during aging.

Purification and characterization of extracellular lipase from a thermotolerant strain: Bacillus subtilis TTP-06.

In current study, lipase from a thermotolerant Bacillus subtilis TTP-06 was purified in a stepwise manner by using ammonium sulfate precipitation and column chromatography. Thenceforth, it was subjected to sodium dodecyl sulfate- and native-polyacrylamide gel electrophoresis to check the homogeneity of the purified enzyme. The ideal substrate concentration, pH, temperature, reaction duration and lipase specificity were identified. With a yield of 11.02%, purified lipase displayed activity of 8.51 U/mg. Thenceforward, the homogeneously purified enzyme was considered to be a homo-dimer of 30kDa subunits. Enzyme had Km and Vmax value of 9.498mM and 19.92molmg-1min-1, respectively. Additionally, the matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) method was used to investigate the purified lipase and estimate its 3-D structure, which revealed a catalytic triad of serine, aspartate and histidine.

Discovery of Bis-sulfonamides as Novel Inhibitors of Mitochondrial NADH-Quinone Oxidoreductase (Complex I).

Mitochondrial oxidative phosphorylation (OXPHOS) is an essential cellular metabolic process that generates ATP. The enzymes involved in OXPHOS are considered to be promising druggable targets. Through screening of an in-house synthetic library with bovine heart submitochondrial particles, we identified a unique symmetric bis-sulfonamide, KPYC01112 (1) as an inhibitor targeting NADH-quinone oxidoreductase (complex I). Structural modifications of KPYC01112 (1) led to the discovery of the more potent inhibitors 32 and 35 possessing long alkyl chains (IC50 = 0.017 and 0.014 μM, respectively). A photoaffinity labeling experiment using a newly synthesized photoreactive bis-sulfonamide ([125I]-43) revealed that it binds to the 49-kDa, PSST, and ND1 subunits which make up the quinone-accessing cavity of complex I.

Purification and characterization of protease M, a yeast mitochondrial nucleotide-stimulated metal protease: its identification as CYM1 gene product, a mitochondrial presequence peptidase.

A chelator-sensitive protease in the mitochondrial matrix of the yeast, Saccharomyces cerevisiae (Biochem. Biophys. Res. Commun. 144, 277, 1987), was purified and characterized. The purified enzyme, termed protease M, specifically hydrolyzes peptide substrates on the N-side of the paired basic residues. When mastoparan was used as substrate, it cleaved Ala8-Leu9 and Lys11-Lys12 bonds as well as the N-side of Lys11-Lys12 residues. Nucleotide triphosphates stimulated the activity 3-fold at 2.5mM. The genomic DNA sequence showed that protease M was a gene product of CYM1 known as mitochondrial presequence protease homologue in S. cerevisiae, encoding a 989-amino acid-long precursor protein. The N-terminal sequence of the purified enzyme indicated that protease M has 16-residue signal sequence and the 'mature' protein consists of 973 amino acids with a molecular mass of 110kDa. Protease M contained consensus sequence motifs of ATP-binding site very near the carboxyl terminus. The alignment of the two ATP-binding motifs is an inverted version of the common alignment. Gene disruption of the enzyme generates mixed subunits in tetrameric MnSOD formed with 23-kDa mature and 24-kDa partial presequence-containing subunits. This report describes newly identified enzyme properties of the CYM1 gene product, protease M and abnormal MnSOD complex formation of the disruption mutant.

RIR1 represses plant immunity by interacting with mitochondrial complex I subunit in rice.

We previously observed decreased expression of rice OsmiR159a.1 on infection with the bacterial blight‐causing pathogen Xanthomonas oryzae pv. oryzae (Xoo), and identified the OsLRR_RLK (leucine‐rich repeat_ receptor like kinase) gene as an authentic target of OsmiR159a.1. Here, we found that a Tos17 insertion mutant of LRR_RLK displayed increasing temporal resistance to Xoo, whereas the LRR_RLK overexpression lines were susceptible to the pathogen early on in the infection, indicating that LRR_RLK encodes a repressor of rice resistance to Xoo infection, and it was renamed as RIR1 (Rice Immunity Repressor 1). RIR1 overexpression plants were more susceptible to Xoo at late growth stage, suggesting that RIR1 mRNA levels are negatively correlated with the resistance of rice against Xoo. We discovered that OsmiR159a.1 repression in Xoo‐infected plants was largely dependent on the pathogen's type III secretion system. Co‐immunoprecipitation, bimolecular fluoresence complementation, and pull‐down assays indicated that RIR1 interacted with the NADH‐ubiquinone oxidoreductase (NUO) 51‐kDa subunit of the mitochondrial complex I through its kinase domain. Notably, impairment of RIR1 or overexpression of NUO resulted in reactive oxygen species accumulation and enhanced expression of pathogen‐resistance genes, including jasmonic acid pathway genes. We propose that pathogens may inhibit OsmiR159 to interfere with the RIR1–NUO interaction, and subsequently depression of rice immune signalling pathways. The resistance genes manipulated by Xoo can be a probe to explore the regulatory network during host–pathogen interactions.

CPSF30-L: A direct connection between mRNA polyadenylation and m6A RNA modification in plants

CPSF30-L: A direct connection between mRNA polyadenylation and m6A RNA modification in plants

IACS-010759, a potent inhibitor of glycolysis-deficient hypoxic tumor cells, inhibits mitochondrial respiratory complex I through a unique mechanism

The small molecule IACS-010759 has been reported to potently inhibit the proliferation of glycolysis-deficient hypoxic tumor cells by interfering with the functions of mitochondrial NADH-ubiquinone oxidoreductase (complex I) without exhibiting cytotoxicity at tolerated doses in normal cells. Considering the significant cytotoxicity of conventional quinone-site inhibitors of complex I, such as piericidin and acetogenin families, we hypothesized that the mechanism of action of IACS-010759 on complex I differs from that of other known quinone-site inhibitors. To test this possibility, here we investigated IACS-010759's mechanism in bovine heart submitochondrial particles. We found that IACS-010759, like known quinone-site inhibitors, suppresses chemical modification by the tosyl reagent AL1 of Asp160 in the 49-kDa subunit, located deep in the interior of a previously proposed quinone-access channel. However, contrary to the other inhibitors, IACS-010759 direction-dependently inhibited forward and reverse electron transfer and did not suppress binding of the quinazoline-type inhibitor [125I]AzQ to the N terminus of the 49-kDa subunit. Photoaffinity labeling experiments revealed that the photoreactive derivative [125I]IACS-010759-PD1 binds to the middle of the membrane subunit ND1 and that inhibitors that bind to the 49-kDa or PSST subunit cannot suppress the binding. We conclude that IACS-010759's binding location in complex I differs from that of any other known inhibitor of the enzyme. Our findings, along with those from previous study, reveal that the mechanisms of action of complex I inhibitors with widely different chemical properties are more diverse than can be accounted for by the quinone-access channel model proposed by structural biology studies.

The luminescent HiBiT peptide enables selective quantitation of G protein–coupled receptor ligand engagement and internalization in living cells

G protein-coupled receptors (GPCRs) are prominent targets to new therapeutics for a range of diseases. Comprehensive assessments of their cellular interactions with bioactive compounds, particularly in a kinetic format, are imperative to the development of drugs with improved efficacy. Hence, we developed complementary cellular assays that enable equilibrium and real-time analyses of GPCR ligand engagement and consequent activation, measured as receptor internalization. These assays utilize GPCRs genetically fused to an N-terminal HiBiT peptide (1.3 kDa), which produces bright luminescence upon high-affinity complementation with LgBiT, an 18-kDa subunit derived from NanoLuc. The cell impermeability of LgBiT limits signal detection to the cell surface and enables measurements of ligand-induced internalization through changes in cell-surface receptor density. In addition, bioluminescent resonance energy transfer is used to quantify dynamic interactions between ligands and their cognate HiBiT-tagged GPCRs through competitive binding with fluorescent tracers. The sensitivity and dynamic range of these assays benefit from the specificity of bioluminescent resonance energy transfer and the high signal intensity of HiBiT/LgBiT without background luminescence from receptors present in intracellular compartments. These features allow analyses of challenging interactions having low selectivity or affinity and enable studies using endogenously tagged receptors. Using the β-adrenergic receptor family as a model, we demonstrate the versatility of these assays by utilizing the same HiBiT construct in analyses of multiple aspects of GPCR pharmacology. We anticipate that this combination of target engagement and proximal functional readout will prove useful to the study of other GPCR families and the development of new therapeutics.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Conformational Changes in HIV-1 Reverse Transcriptase that Facilitate Its Maturation

HIV-1 reverse transcriptase (RT) is translated as part of the Gag-Pol polyprotein that is proteolytically processed by HIV-1 protease (PR) to finally become a mature heterodimer, composed of a p66 and a p66-derived 51-kDa subunit, p51. Our previous work suggested that tRNALys3 binding to p66/p66 introduces conformational changes in the ribonuclease (RNH) domain of RT that facilitate efficient cleavage of p66 to p51 by PR. In this study, we characterized the conformational changes in the RNH domain of p66/p66 imparted by tRNALys3 using NMR. Moreover, the importance of tRNALys3 in RT maturation was confirmed in cellulo by modulating the levels of Lys-tRNA synthetase, which affects recruitment of tRNALys3 to the virus. We also employed nonnucleoside RT inhibitors, to modulate the p66 dimer-monomer equilibrium and monitor the resulting structural changes. Taken together, our data provide unique insights into the conformational changes in p66/p66 that drive PR cleavage.

Defining the mechanism of action of S1QELs, specific suppressors of superoxide production in the quinone-reaction site in mitochondrial complex I

Site-specific suppressors of superoxide production (named S1QELs) in the quinone-reaction site in mitochondrial respiratory complex I during reverse electron transfer have been previously reported; however, their mechanism of action remains elusive. Using bovine heart submitochondrial particles, we herein investigated the effects of S1QELs on complex I functions. We found that the inhibitory effects of S1QELs on complex I are distinctly different from those of other known quinone-site inhibitors. For example, the inhibitory potencies of S1QELs significantly varied depending on the direction of electron transfer (forward or reverse). S1QELs marginally suppressed the specific chemical modification of Asp160 in the 49-kDa subunit, located deep in the quinone-binding pocket, by the tosyl chemistry reagent AL1. S1QELs also failed to suppress the binding of a photoreactive quinazoline-type inhibitor ([125I]AzQ) to the 49-kDa subunit. Moreover, a photoaffinity labeling experiment with photoreactive S1QEL derivatives indicated that they bind to a segment in the ND1 subunit that is not considered to make up the binding pocket for quinone or inhibitors. These results indicate that unlike known quinone-site inhibitors, S1QELs do not occupy the quinone- or inhibitor-binding pocket; rather, they may indirectly modulate the quinone-redox reactions by inducing structural changes of the pocket through binding to ND1. We conclude that this indirect effect may be a prerequisite for S1QELs' direction-dependent modulation of electron transfer. This, in turn, may be responsible for the suppression of superoxide production during reverse electron transfer without significantly interfering with forward electron transfer.

Photoaffinity Labeling of Respiratory Complex I in Bovine Heart Submitochondrial Particles by Photoreactive [125I] amilorides.

The architecture of quinone/inhibitor-access channel in proton-translocating NADH-quinone oxidoreductase (respiratory complex I) was modeled by X-ray crystallography and cryo-EM, however, it remains debatable whether the channel model reflects the physiologically relevant state present throughout the catalytic cycle. Using photoreactive [125I]amilorides, we demonstrated that amiloride-type inhibitors bind to the interfacial region of multiple subunits (49-kDa, ND1, PSST, and 39-kDa subunits), which is difficult to reconcile with the current channel model. This report describes the procedures for photoaffinity labeling of bovine submitochondrial particles by photoreactive [125I]amilorides. The protocol could be widely applicable for the characterization of various biologically active compounds, whose target protein remains to be identified or characterized.

Exploring the quinone/inhibitor-binding pocket in mitochondrial respiratory complex I by chemical biology approaches

NADH-quinone oxidoreductase (respiratory complex I) couples NADH-to-quinone electron transfer to the translocation of protons across the membrane. Even though the architecture of the quinone-access channel in the enzyme has been modeled by X-ray crystallography and cryo-EM, conflicting findings raise the question whether the models fully reflect physiologically relevant states present throughout the catalytic cycle. To gain further insights into the structural features of the binding pocket for quinone/inhibitor, we performed chemical biology experiments using bovine heart sub-mitochondrial particles. We synthesized ubiquinones that are oversized (SF-UQs) or lipid-like (PC-UQs) and are highly unlikely to enter and transit the predicted narrow channel. We found that SF-UQs and PC-UQs can be catalytically reduced by complex I, albeit only at moderate or low rates. Moreover, quinone-site inhibitors completely blocked the catalytic reduction and the membrane potential formation coupled to this reduction. Photoaffinity-labeling experiments revealed that amiloride-type inhibitors bind to the interfacial domain of multiple core subunits (49 kDa, ND1, and PSST) and the 39-kDa supernumerary subunit, although the latter does not make up the channel cavity in the current models. The binding of amilorides to the multiple target subunits was remarkably suppressed by other quinone-site inhibitors and SF-UQs. Taken together, the present results are difficult to reconcile with the current channel models. On the basis of comprehensive interpretations of the present results and of previous findings, we discuss the physiological relevance of these models.

Specificity of the IgG antibody response to Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, and Plasmodium ovale MSP119 subunit proteins in multiplexed serologic assays

BackgroundMultiplex bead assays (MBA) that measure IgG antibodies to the carboxy-terminal 19-kDa sub-unit of the merozoite surface protein 1 (MSP119) are currently used to determine malaria seroprevalence in human populations living in areas with both stable and unstable transmission. However, the species specificities of the IgG antibody responses to the malaria MSP119 antigens have not been extensively characterized using MBA.MethodsRecombinant Plasmodium falciparum (3D7), Plasmodium malariae (China I), Plasmodium ovale (Nigeria I), and Plasmodium vivax (Belem) MSP119 proteins were covalently coupled to beads for MBA. Threshold cut-off values for the assays were estimated using sera from US citizens with no history of foreign travel and by receiver operator characteristic curve analysis using diagnostic samples. Banked sera from experimentally infected chimpanzees, sera from humans from low transmission regions of Haiti and Cambodia (N = 12), and elutions from blood spots from humans selected from a high transmission region of Mozambique (N = 20) were used to develop an antigen competition MBA for antibody cross-reactivity studies. A sub-set of samples was further characterized using antibody capture/elution MBA, IgG subclass determination, and antibody avidity measurement.ResultsTotal IgG antibody responses in experimentally infected chimpanzees were species specific and could be completely suppressed by homologous competitor protein at a concentration of 10 μg/ml. Eleven of 12 samples from the low transmission regions and 12 of 20 samples from the high transmission area had antibody responses that were completely species specific. For 7 additional samples, the P. falciparum MSP119 responses were species specific, but various levels of incomplete heterologous competition were observed for the non-P. falciparum assays. A pan-malaria MSP119 cross-reactive antibody response was observed in elutions of blood spots from two 20–30 years old Mozambique donors. The antibody response from one of these two donors had low avidity and skewed almost entirely to the IgG3 subclass.ConclusionsEven when P. falciparum, P. malariae, P. ovale, and P. vivax are co-endemic in a high transmission setting, most antibody responses to MSP119 antigens are species-specific and are likely indicative of previous infection history. True pan-malaria cross-reactive responses were found to occur rarely.

Identification of Amino Acid Residues Responsible for Inhibition of Host Gene Expression by Influenza A H9N2 NS1 Targeting of CPSF30.

H9N2 influenza A viruses (IAV) are considered low pathogenic avian influenza viruses (LPAIV). These viruses are endemic in poultry in many countries in Asia, the Middle East and parts of Africa. Several cases of H9N2-associated infections in humans as well as in pigs have led the World Health Organization (WHO) to include these viruses among those with pandemic potential. To date, the processes and mechanisms associated with H9N2 IAV adaptation to mammals are poorly understood. The non-structural protein 1 (NS1) from IAV is a virulence factor that counteracts the innate immune responses. Here, we evaluated the ability of the NS1 protein from A/quail/Hong Kong/G1/97 (HK/97) H9N2 to inhibit host immune responses. We found that HK/97 NS1 protein counteracted interferon (IFN) responses but was not able to inhibit host gene expression in human or avian cells. In contrast, the NS1 protein from earlier H9N2 IAV strains, including the first H9N2 A/turkey/Wisconsin/1/1966 (WI/66), were able to inhibit both IFN and host gene expression. Using chimeric constructs between WI/66 and HK/97 NS1 proteins, we identified the region and amino acid residues involved in inhibition of host gene expression. Amino acid substitutions L103F, I106M, P114S, G125D and N139D in HK/97 NS1 resulted in binding to the 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF30) and, in consequence, inhibition of host gene expression. Notably, changes in the same amino acid residues resulted in the lack of inhibition of host gene expression by WI/66 NS1. Importantly, our results identified a new combination of amino acids required for NS1 binding to CPSF30 and inhibition of host gene expression. These results also confirm previous studies demonstrating strain specific differences in the ability of NS1 proteins to inhibit host gene expression.

Structural analyses reveal the mechanism of inhibition of influenza virus NS1 by two antiviral compounds

The influenza virus is a significant public health concern causing 250,000-500,000 deaths worldwide each year. Its ability to change quickly results in the potential for rapid generation of pandemic strains for which most individuals would have no antibody protection. This pandemic potential highlights the need for the continuous development of new drugs against influenza virus. As an essential component and well established virulence determinant, NS1 (nonstructural protein 1) of influenza virus is a highly prioritized target for the development of anti-influenza compounds. Here, we used NMR to determine that the NS1 effector domain (NS1ED) derived from the A/Brevig Mission/1/1918 (H1N1) strain of influenza (1918H1N1) binds to two previously described anti-influenza compounds A9 (JJ3297) and A22. We then used X-ray crystallography to determine the three-dimensional structure of the 1918H1N1 NS1ED Furthermore, we mapped the A9/A22-binding site onto our 1918H1N1 NS1ED structure and determined that A9 and A22 interact with the NS1ED in the hydrophobic pocket known to facilitate binding to the 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF30), suggesting that the two compounds likely attenuate influenza replication by inhibiting the NS1ED-CPSF30 interaction. Finally, our structure revealed that NS1ED could dimerize via an interface that we termed the α3-α3 dimer. Taken together, the findings presented here provide strong evidence for the mechanism of action of two anti-influenza compounds that target NS1 and contribute significant structural insights into NS1 that we hope will promote and inform the development and optimization of influenza therapies based on A9/A22.

Acute O2 Sensing: Role of Coenzyme QH2/Q Ratio and Mitochondrial ROS Compartmentalization

Acute O2 sensing by peripheral chemoreceptors isessential for mammalian homeostasis. Carotid body glomus cells contain O2-sensitive ion channels, which trigger fast adaptive cardiorespiratory reflexes in response to hypoxia. O2-sensitive cells have unique metabolic characteristics that favor the hypoxic generation of mitochondrial complex I (MCI) signaling molecules, NADH and reactive oxygen species (ROS), which modulate membrane ion channels. We show that responsiveness to hypoxia progressively disappears after inducible deletion of the Ndufs2 gene, which encodes the 49kDa subunit forming the coenzyme Q binding site in MCI, even in the presence of MCII substrates and chemical NAD+ regeneration. We also show contrasting effects of physiological hypoxia on mitochondrial ROS production (increased in the intermembrane space and decreased in the matrix) and a marked effect of succinate dehydrogenase activity on acute O2 sensing. Our results suggest that acute responsiveness tohypoxia depends on coenzyme QH2/Q ratio-controlled ROS production in MCI.

The K186E Amino Acid Substitution in the Canine Influenza Virus H3N8 NS1 Protein Restores Its Ability To Inhibit Host Gene Expression.

Canine influenza viruses (CIVs) are the causative agents of canine influenza, a contagious respiratory disease in dogs, and include the equine-origin H3N8 and the avian-origin H3N2 viruses. Influenza A virus (IAV) nonstructural protein 1 (NS1) is a virulence factor essential for counteracting the innate immune response. Here, we evaluated the ability of H3N8 CIV NS1 to inhibit host innate immune responses. We found that H3N8 CIV NS1 was able to efficiently counteract interferon (IFN) responses but was unable to block general gene expression in human or canine cells. Such ability was restored by a single amino acid substitution in position 186 (K186E) that resulted in NS1 binding to the 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF30), a cellular protein involved in pre-mRNA processing. We also examined the frequency distribution of K186 and E186 among H3N8 CIVs and equine influenza viruses (EIVs), the ancestors of H3N8 CIV, and experimentally determined the impact of amino acid 186 in the ability of different CIV and EIV NS1s to inhibit general gene expression. In all cases, the presence of E186 was responsible for the control of host gene expression. In contrast, the NS1 protein of H3N2 CIV harbors E186 and blocks general gene expression in canine cells. Altogether, our results confirm previous studies on the strain-dependent ability of NS1 to block general gene expression. Moreover, the observed polymorphism on amino acid 186 between H3N8 and H3N2 CIVs might be the result of adaptive changes acquired during long-term circulation of avian-origin IAVs in mammals.IMPORTANCE Canine influenza is a respiratory disease of dogs caused by two CIV subtypes, the H3N8 and H3N2 viruses, of equine and avian origins, respectively. Influenza NS1 is the main viral factor responsible for the control of host innate immune responses, and changes in NS1 can play an important role in host adaptation. Here we assessed the ability of H3N8 CIV NS1 to inhibit host innate immune responses and gene expression. The H3N8 CIV NS1 did not block host gene expression, but this activity was restored by a single amino acid substitution (K186E), which was responsible for NS1 binding to the host factor CPSF30. In contrast, the H3N2 CIV NS1, which contains E186, blocks general gene expression. Our results suggest that the ability to block host gene expression is not required for influenza virus replication in mammals but might be important in the long-term adaptation of avian-origin influenza viruses to mammals.

Physicochemical characteristics and functionality of tree peony (Paeonia suffruticosa Andr.) seed protein

The physicochemical and functional properties of tree peony seed protein were investigated. Tree peony seed protein with a favourable amino acid profile was composed of a 60kDa protein with two subunits of 38 and 23kDa. The isoelectric points of the two subunits were 3.6 and 9.0. Moreover, acid-Schiff staining indicated both of them were glycoproteins. Diagonal and 2-D electrophoresis data indicated the 38kDa subunit included three types, which two types had inter-disulphide bonds and one type had no-disulphide bonds. So did the 23kDa subunit. Circular dichroism spectra indicated the tree peony seed protein had predominantly a β-sheet structure. Differential scanning calorimetry analysis indicated the denaturation temperatures of the tree peony seed protein at pH 5.0, 7.0 and 9.0 were 92.0, 97.1 and 95.2°C, respectively. Tree peony seed protein could be a food ingredient in the food industry due to its desirable physicochemical and functional properties.