23F Isolates Research Articles

Rarely Occurring 19A-Like cps Locus from a Serotype 19F Pneumococcal Isolate Indicates Continued Need of Serology-Based Quality Control for PCR-Based Serotype Determinations

Determination of the DNA sequences corresponding to all 91 pneumococcal capsular biosynthetic (cps) loci (1, 3, 6, 9) has allowed serotype determinations from pneumococcal isolates and clinical specimens using conventional PCR assays (2, 4, 7, 8, 10). We developed sequential, multiplexed PCR schemes that resolve 33 serologic specificities, including 20 serotypes and 13 serotype subsets (4, 7, 8). We recently expanded the scheme to 40 specificities (www.cdc.gov/ncidod/biotech/strep/pcr.htm). PCR primers targeted serotype-specific open reading frames within central portions of known cps loci (4, 7, 8). Subsequent information (1, 3, 6) revealed that we primarily targeted serotype-specific oligosaccharide repeat unit polymerases (wzy encoded), glycosyl transferases, and flippases (wzx encoded). Our serotype 19A primers, however, targeted the mnaA gene that encodes UDP-N-acetylglucosamine-2-epimerase (8). Although the mnaA sequence differs markedly among the 15 cps loci that harbor it (serotypes 19A, -B, -C, -F; 12A, -B, -F; 9A, -N, -L, -V; 4; 36; 44; 46), due to potential exchanges of heterologous mnaA genes, we recently changed the 19A PCR assay to target wzy (our unpublished data). The wzy19A and wzy19F genes putatively provide the basis of the structural difference between the related 19A and 19F capsules (1). Recently, we evaluated Streptococcus pneumoniae strain 2584-08(19F) that was typed as 19F using the serology-based reaction and found that it yielded a false-positive 19A result with our mnaA-based assay as well as a false-negative 19F PCR result using our wzy19F-specific assay. We found that this strain had an apparently rare multilocus sequence genotype 3040 (ST3040) that is not related to other known genotypes. Strain 2584-08(19F) reactivity with seven different monoclonal antibodies targeting 19A and/or 19F (5, 11) was consistent with results from previously characterized 19F strains (M. H. Nahm, unpublished data). We retrospectively tested 71 diverse 19F isolates using the 19A mnaA assay and found no false positives. We also found no discrepant results among 100 mnaA PCR-based 19A isolates also determined to be 19A based upon quellung reaction results. Unexpectedly, upon testing strain 2584-08(19F) using our newer 19A assay based upon the wzy19A gene sequence (completely conserved within the three available cps19A loci), we again obtained a false-positive 19A result. Using primers 19AFwzyF (5′TTGAAGTTGATGAAAGAAAACGAGG) and 19AFwzyR (5′ATAAAGTTGCCAGTAACTGTACTC), we subsequently amplified and sequenced the 1,335-bp wzy structural gene from 2584-08(19F) and found that the sequence (GenBank accession no. {type:entrez-nucleotide,attrs:{text:FJ829071,term_id:229559728,term_text:FJ829071}}FJ829071) shared 88% sequence identity with wzy19A from known 19A cps loci (GenBank accession no {type:entrez-nucleotide,attrs:{text:CR931675,term_id:68643359,term_text:CR931675}}CR931675 is representative) and only 78% identity with wzy19F from known 19F cps loci (GenBank accession no. {type:entrez-nucleotide,attrs:{text:CR931678,term_id:68643444,term_text:CR931678}}CR931678 is representative). As expected, we found near identity to the wzy19A-based primers and marked divergence from our standard wzy19F-based typing primers. Subsequently, we formulated new serotype 19A identification primers (19AF3 [5′ GAGAGATTCATAATCTTGCACTTAGCCA] and 19AR3 [5′ CATAATAGCTACAAATGACTCATCGCC]) based upon differences between wzy19A and all other wzy genes, including the 2584-08(19F) wzy gene. The current wzy19A-based PCR assay tested positive against 42 serotype 19A isolates and was negative against 31 diverse 19F isolates, including 2584-08(19F). Due to the high homology of the wzy gene of 2584-08(19F) with the serotype 19A wzy gene, we are unable to design a new wzy-specific primer set that would be specific for both 2594-08(19F) and commonly recovered type 19F isolates without giving false-positive PCR results for 19A isolates. We place more priority upon eliminating rare false-positive 19A results than illuminating rarely encountered false nontypeable results for serotype 19F. Based upon cumulative results from concurrent serology- and PCR-based testing of diverse isolate sets, we are confident that the sequential PCR assay is accurate for the vast majority of isolates. However, in view of this newly identified potential for false-positive 19A results, we will continue quellung serotyping in parallel with sequential PCR-based serotype determination until biologically based sequence signatures are identified for each serotype.

Distribution of capsular serotypes and macrolide resistance mechanisms among macrolide-resistant Streptococcus pneumoniae isolates in Korea

The mechanism of macrolide resistance was investigated in 251 Streptococcus pneumoniae isolates with reduced susceptibility to erythromycin (erythromycin-resistant S. pneumoniae [ERSP]) collected during the period from 2000 to 2004 in Korea. Among these strains, erm(B) was the most prevalent pneumococcal macrolide resistance genotype. In particular, dual mechanisms of both the erm(B) and mef(A) genes were detected in 77 (30.7%) of 251 ERSP isolates. All of the 77 ERSP isolates, with dual erm(B) and mef(A), showed resistance to 2 or more antimicrobial agents, including penicillin, cefotaxime, clindamycin, tetracycline, and levofloxacin. Serotypes 19F, 23F, 19A, 14, 11A, 6B, 6A, and 9V accounted for 73.3% of ERSP isolates. Most of the strains with serotypes 19F (77.2%) or 19A (87.5%) had the dual erm(B) and mef(A) genes. The prevalence and spread of serotype 19F or 19A isolates may have contributed to the high rate of macrolide-resistant pneumococci in Korea. In addition, we identified the emergence of a macrolide-nonsusceptible nonvaccine serotype 35B, which carries mef(A)-mediated resistance to macrolides. These findings emphasize the need for a continuous monitoring of macrolide-resistant S. pneumoniae in Korea.

Highly Variable Penicillin Resistance Determinants PBP 2x, PBP 2b, and PBP 1a in Isolates of Two Streptococcus pneumoniae Clonal Groups, Poland 23F -16 and Poland 6B -20

Penicillin-binding proteins (PBPs) in representatives of two Streptococcus pneumoniae clonal groups that are prevalent in Poland, Poland 23F-16 and Poland 6B-20, were investigated by PBP profile analysis, antibody reactivity pattern analysis, and DNA sequence analysis of the transpeptidase (TP) domain-encoding regions of the pbp2x, pbp2b, and pbp1a genes. The isolates differed in their MICs of beta-lactam antibiotics. The majority of the 6B isolates were intermediately susceptible to penicillin (penicillin MICs, 0.12 to 0.5 microg/ml), whereas all 23F isolates were penicillin resistant (MICs, >or=2 microg/ml). The 6B isolates investigated had the same sequence type (ST), determined by multilocus sequence typing, as the Poland 6B-20 reference strain (ST315), but in the 23F group, isolates with three distinct single-locus variants (SLVs) in the ddl gene (ST173, ST272, and ST1506) were included. None of the isolates showed an identical PBP profile after labeling with Bocillin FL and sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and only one pair of 6B isolates and one pair of 23F isolates (ST173 and ST272) each contained an identical combination of PBP 2x, PBP 2b, and PBP 1a TP domains. Some 23F isolates contained PBP 3 with an apparently higher electrophoretic mobility, and this feature also did not correlate with their STs. The data document a highly variable pool of PBP genes as a result of multiple gene transfer and recombination events within and between different clonal groups.

Spread of the Streptococcus pneumoniae Taiwan19F-14 clone among children in Greece

Serotype 19F pneumococci were a leading cause of infections among children in Athens, Greece during 2001-2006. In total, 143 19F isolates were typed by pulsed-field gel electrophoresis (PFGE), and 38 isolates representing the main PFGE types were also characterised by multilocus sequence typing. A diversity of distinct strains belonging to sequence types 236, 1035, 274, 172 and 319 were identified, but multidrug-resistant isolates related to the Taiwan(19F)-14 clone (ST236) constituted 76.9% of the isolates. Spread of the Taiwan(19F)-14 clone explains, in part, the high incidence of antibiotic resistance observed among pneumococci reported recently from Athens.

Clonal success of piliated penicillin nonsusceptible pneumococci

Antibiotic resistance in pneumococci is due to the spread of strains belonging to a limited number of clones. The Spain(9V)-3 clone of sequence type (ST)156 is one of the most successful clones with reduced susceptibility to penicillin [pneumococci nonsusceptible to penicillin (PNSP)]. In Sweden during 2000-2003, a dramatic increase in the number of PNSP isolates was observed. Molecular characterization of these isolates showed that a single clone of sequence type ST156 increased from 40% to 80% of all serotype 14, thus causing the serotype expansion. Additionally, during the same time period, we examined the clonal composition of two serotypes 9V and 19F: all 9V and 20% of 19F isolates belonged to the clonal cluster of ST156, and overall approximately 50% of all PNSP belonged to the ST156 clonal cluster. Moreover, microarray and PCR analysis showed that all ST156 isolates, irrespective of capsular type, carried the rlrA pilus islet. This islet was also found to be present in the penicillin-sensitive ST162 clone, which is believed to be the drug-susceptible ancestor of ST156. Competitive experiments between related ST156 serotype 19F strains confirmed that those containing the rlrA pilus islet were more successful in an animal model of carriage. We conclude that the pilus island is an important biological factor common to ST156 isolates and other successful PNSP clones. In Sweden, a country where the low antibiotic usage does not explain the spread of resistant strains, at least 70% of all PNSP isolates collected during year 2003 carried the pilus islet.

Clonal dissemination of macrolide-resistant and penicillin-susceptible serotype 3 and penicillin-resistant Taiwan 19F-14 and 23F-15 Streptococcus pneumoniae isolates in Japan: a pilot surveillance study.

Large-scale surveillance studies using molecular techniques such as pulsed-field gel electrophoresis (PFGE) have revealed that the spread of antibiotic-resistant pneumococci is due to clonal spread. However, in Japan, surveillance studies using such molecular techniques have never been done. Therefore, we conducted a pilot surveillance study to elucidate the present situation in Japan. Among the 145 isolates examined, the most prevalent serotype was type 19F (20%), for which most isolates were not susceptible to penicillin (86.2%) but were positive for the mef(A)/mef(E) gene (89.7%). The secondmost prevalent was serotype 3 (16.6%), for which most isolates were susceptible to penicillin (87.5%) and positive for the erm(B) gene (91.7%). PFGE analysis showed that both serotypes consisted mainly of clonally identical or related isolates and, in particular, 38% of the type 19F isolates were indistinguishable from or closely related to the Taiwan 19F-14 clone. In addition, some of the Japanese type 23F isolates with the erm(B) gene were indistinguishable from or related to the Taiwan 23F-15 clone as analyzed by PFGE. Based on the results of our pilot study performed in a single institution, it is likely that international antibiotic-resistant clones have already spread in Japan; therefore, a nationwide surveillance study should be urgently conducted.

Emergence of Penicillin‐NonsusceptibleStreptococcus pneumoniaeClones Expressing Serotypes Not Present in the Antipneumococcal Conjugate Vaccine

Penicillin-nonsusceptible Streptococcus pneumoniae isolates are confined mainly to a few serogroups. Capsular transformation may serve as a mechanism for spreading antibiotic resistance to new serotypes. Antibiogram and molecular typing, by pulsed-field gel electrophoresis (PFGE), were performed on 46 nasopharyngeal and middle ear fluid (MEF) isolates expressing serotype 11A, 45 MEF isolates expressing serotype 15B/C (recovered during 1998-2003 from Israeli children <5 years old), and 57 MEF isolates expressing serotype 19F (recovered during 1998-2001 from Costa Rican children <7.5 years old). PFGE patterns showed that 49 (86%) of 57 serotype 19F isolates and 19 (41%) of 46 serotype 15B/C isolates were closely related. The vast majority of these isolates (80% of serotype 19F and 100% of serotype 15B/C isolates) were nonsusceptible to penicillin. Multilocus sequence typing (MLST) data show that the serotype 15B/C isolates belonged to the ST346 cluster, whereas the serotype 19F isolates were a single-locus variant of ST346. For serotype 11A isolates, PFGE patterns and MLST analysis showed that 8 (80%) of the 10 penicillin-nonsusceptible isolates belonged to a single clone--namely, ST156--which was identical to the international Spain9V-3 clone. Penicillin-nonsusceptible pneumococcal clones of serotypes not related to those included in the 11-valent conjugate vaccines may derive from capsular transformation of vaccine-related serotypes. Of particular concern was the detection of serotype 11A variants of the successful international Spain9V-3 clone. This phenomenon, although seemingly rare at present, can have implications for the long-term effectiveness of the conjugate vaccines.

Characterization of German penicillin non-susceptible serotype 23F pneumococci using multilocus sequence typing.

Three nationwide multicentre studies (n = 5071) showed an increase in antibiotic resistance in pneumococci in Germany. Serotype 23F was the predominant serotype (n = 45, 22.4 %), followed by 6B (n = 30, 14.9 %) and 9V (n = 19, 9.5 %). Multilocus sequence typing was used to characterize 45 serotype 23F strains with reduced penicillin susceptibility. The Spanish(23F)-1 clone [profile 4-4-2-4-4-1-1, sequence type (ST) 81] contributes significantly to the emergence of penicillin resistance in Germany (n = 21, 46.7 % of all penicillin non-susceptible serotype 23F isolates). Isolates of ST 277 (profile 7-13-8-6-6-12-8), which has been found previously in the Netherlands, are also observed, particularly in western Germany (n = 8, 17.8 %). A high proportion of strains (n = 11, 24.4 %) have sequence types that have not been reported to date from other countries (STs 353-362). The major penicillin-resistant clones are present in Germany, a country with relatively low levels of beta-lactam resistance.

Caracterización molecular de aislamientos invasores de Streptococcus pneumoniae resistentes a la penicilina recuperados de pacientes adultos.

Streptococcus pneumoniae penicillin resistance is associated with the international dispersion of specifically identified strains. In Colombia, the presence and circulation of resistant strains Spain23F-1, Spain6B-2, Spain9V and Colombian23F-25 has been demonstrated in children less than 5 years old. Strain identities were established for 80 penicillin resistant S. pneumoniae isolates recovered from Colombian adult patients. Three approaches to genotypic characterization of the strains wrere used: a) chromosomal DNA was digested with Sma 1, and the products subjected to pulse-field gel electrophoresis (PFGE); b) restriction enzyme fragment comparison of the penicillin binding protein genes (pbp 1a, 2b and 2x), and c) pneumococcal surface protein A (PspA) family. The results showed that 2.5% of the isolates were genetically related to Spain23F-1 clone, 10% to Spain6B-2 clone, 37.5% to Spain9V-3, in addition, 14% of the capsular type 23F isolates were related to the Colombia23F-25 clone and demonstrated an intermediate level resistance to penicillin. Wide spread circulation of international strains as well as a Colombian strain highlighted the importance of these clones in maintaining the prevalence of resistance to penicillin in Colombia.

Presence of international multiresistant clones of Streptococcus pneumoniae in Colombia.

In Colombia, penicillin resistance of Streptococcus pneumoniae invasive isolates recovered from children less than 5 years old has increased from 10% in 1994 to 49.4% in 1999, suggesting the circulation of international resistant clones in the country. A total of 167 S. pneumoniae invasive isolates with diminished susceptibility to penicillin (DSP) were studied. The techniques used were pulsed-field gel electrophoresis (PFGE) and restriction fragment length polymorphism (RFLP) of penicillin-binding proteins (PBPs) genes (2B, 2X, and 1A). Forty-nine serotype 23F isolates were grouped in two clusters: 15 (31%) multiresistant isolates showed PFGE pattern A and PBP I profile, thus making them indistinguishable from Spain23F-1 clone, and 34 (69%) with PFGE pattern C, PBP II profile, and intermediate level resistance (ILR) to penicillin and TMP-SMX, features unique to a Colombian clone. Fifty-five serotype 14 isolates were assigned to PFGE B pattern, PBP III profile, having high-level resistance to penicillin, and TMP-SMX, similar to the France9V variant 14. This same pattern was present in five capsular type 9V isolates. Four serotype 14 isolates were assigned to PFGE pattern F, and appeared to be similar to Slovakia(14)-10 PFGE pattern, although they had different PBP profiles. Nine capsular type 6B and one 6A isolates belonged to PFGE pattern M, similar to Spain6B-2, although they showed different PBP profiles. The remaining 44 isolates, corresponding to serotypes 14, 6B, 19F, and 34, showed variable PFGE and PBP patterns. These results show that as many as two international clones may be circulating in Colombia as well as a unique, widely distributed 23F clone with ILR to penicillin. Additionally, some Colombian isolates capsular type 14 and 6B might be related to Slovakia(14)-10 Spain6B-2 clones, respectively.

Persistence of two invasive Streptococcus pneumoniae clones of serotypes 1 and 5 in comparison to that of multiple clones of serotypes 6B and 23F among children in southern Israel.

We conducted a study to examine the clonal distribution of invasive serotype 1 and 5 isolates as representatives of serotypes that are rarely carried by healthy individuals compared to that of invasive serotype 6B and 23F isolates as representatives of serotypes often carried by young children for prolonged periods. All invasive serotype 1, 5, 6B, and 23F isolates recovered from blood cultures during January 1995 to May 1999 were analyzed; these included 66 serotype 1, 30 serotype 5, 11 serotype 6B, and 15 serotype 23F isolates. One hundred thirty-three nasopharyngeal (NP) isolates of the indicated four serotypes from healthy children were also studied. The strains were characterized using serotyping, antimicrobial susceptibility testing, and pulsed-field gel electrophoresis profiling. We found that both invasive and NP serotype 1 and 5 isolates were susceptible to penicillin and that each serotype showed only one clonal type. In contrast, serotype 6B and 23F strains showed different phenotypic characteristics as well as multiple clonal types; 10 clones were identified among 6B isolates, and 11 clones were identified among 23F isolates.

Novel penicillin-, cephalosporin-, and macrolide-resistant clones of Streptococcus pneumoniae serotypes 23F and 19F in Taiwan which differ from international epidemic clones.

A cluster (14 of 18) of Streptococcus pneumoniae serotype 23F isolates that were resistant to penicillin (PEN), cephalosporin, and macrolide was found in one day care center in Kaohsiung, Taiwan. We analyzed the 18 isolates by pulsed field gel electrophoresis (PFGE). All but one serotype 23F isolate demonstrated identical PFGE patterns, which were different from the established pattern of the internationally spread Spanish 23F clone. The three strains of serotype 19F also showed a uniform pattern. These data strongly suggest that two novel clones of PEN-, cephalosporin-, and macrolide-resistant S. pneumoniae serotypes 23F and 19F are present in Taiwan.

Genotypic survey of recent beta-lactam-resistant pneumococcal nasopharyngeal isolates from asymptomatic children in Chile.

To assess pneumococcal strain variability among young asymptomatic carriers in Chile, we used serotyping, antibiotic susceptibility testing, and genotyping to analyze 68 multidrug-resistant pneumococcal isolates recovered from 54 asymptomatic children 6 to 48 months of age. The isolates represented capsular serotypes 19F (43 isolates), 14 (14 isolates), 23F (7 isolates), 6B (3 isolates), and 6A (1 isolate). Genotypic analysis, which included pulsed-field gel electrophoresis (PFGE) of chromosomal digests, penicillin binding protein (PBP) gene fingerprinting, and dhf gene fingerprinting, revealed that the isolates represented six different genetic lineages. Clear circumstantial evidence of capsular switching was seen within each of four of the genetically related sets. The majority of the isolates, consisting of the 43 19F isolates and 2 type 6B isolates, appeared to represent a genetically highly related set distinct from previously characterized pneumococcal strains. Each of three other genetically defined lineages was closely related to one of the previously characterized clones Spain(6B)-2, France(9V)-3, or Spain(23F)-1. A fifth lineage was comprised of four type 23F isolates that, by the techniques used for this study, were genetically indistinguishable from three recent type 19F sterile-site isolates from the United States. Finally, a sixth lineage was represented by a single type 23F isolate which had a unique PFGE type and unique PBP and dhf gene fingerprints.

Evidence of clonal dissemination of multidrug-resistant Streptococcus pneumoniae in Hong Kong.

The relationship between the phenotypic and genotypic characteristics of 105 penicillin-intermediate or -resistant Streptococcus pneumoniae isolates saved during 1994 to 1997 at the Prince of Wales Hospital and Pamela Youde Nethersole Eastern Hospital, Hong Kong, was studied. The pbp genes for penicillin-binding proteins 1a, 2b, and 2x for each isolate were amplified by PCR, and the products were digested with restriction enzymes HinfI and AluI. A combination of the pulsed-field gel electrophoresis (PFGE) profiles, pbp fingerprints, and phenotypic characteristics of capsular types and antibiograms enabled these isolates to be divided into four major groups. Seventy-four percent (78 of 105) of the strains, belonging to serotypes 23F, 19F, and 14, showed indistinguishable pbp fingerprint patterns (group A1, 1-1-1, 1-1-1), with PFGE patterns belonging to group A and its subtypes, suggesting that these strains were closely related. Eighty-three percent (65 of 78) of these isolates were also resistant to tetracycline, erythromycin, chloramphenicol, and trimethoprim. The type 23F isolates were indistinguishable from representative strains of the Spanish 23F clone by these molecular methods, indicating that these strains may be variants of the Spanish 23F clone. Serotype 6B accounted for 19% (20 of 105) of the isolates with reduced penicillin susceptibility and was made up of variants belonging to four different pbp fingerprint groups with the PFGE pattern group B, the predominant group being indistinguishable from that of the Spanish 6B clone. Other PFGE and fingerprint groups were mainly obtained from penicillin-susceptible strains of various serotypes. The results suggest that the rapid emergence of drug-resistant S. pneumoniae in Hong Kong has been due to the rapid dissemination of several successful clones.

Increase in penicillin resistance rates in Belgium due to clonal spread of a penicillin-resistant 23F Streptococcus pneumoniae strain.

In 1994 a sudden increase in penicillin resistance was observed in Belgium among invasive pneumococci. To determine whether this increase was due to clonal spread of a resistant strain or to de novo acquisition of penicillin resistance, pneumococci of capsular types 23F, 19, 14, 9, and 6 isolated in 1993 and 1994, were analyzed by capsular serotyping and DNA macrorestriction analysis, resolved by pulsed-field gel electrophoresis. Furthermore, pneumococcal isolates from northern France, a region with a high prevalence of penicillin resistance, and from southern Belgium, a region with a low but increasing prevalence of penicillin resistance, were analyzed. The rate of resistance of invasive pneumococci to penicillin increased from 2.3% in 1993 to 7.6% in 1994. Pneumococcal serotype 23F represented 26.7% of the penicillin-resistant isolates in 1993 and 40.4% in 1994, while the prevalence of serotype 23F decreased from 10.9% in 1993 to 8.8% in 1994. In 1994 up to 35.8% of serotype 23F isolates were penicillin resistant. The Belgian penicillin-resistant 23F isolates from 1994 were genetically closely related to the French 23F penicillin-resistant isolates and, as clones were clearly distinct from the other serotypes as well as from the penicillin-susceptible 23F isolates. These data demonstrate the important contribution of the clonal spread of a penicillin-resistant pneumococcal strain in the overall increase of penicillin resistance in our country.

Molecular characterization of penicillin-resistant Streptococcus pneumoniae isolates from Bulgaria.

As part of an ongoing surveillance program of antibiotic-resistant Streptococcus pneumoniae in Sofia, Bulgaria, 120 penicillin-resistant strains (PRSP) (most of them recovered from children hospitalized with pneumococcal disease) were analyzed by microbiological and molecular methods. Several unique features of this collection are of particular interest. (i) Most isolates (112 of 120) were also resistant to trimethoprim-sulfamethoxazole (SXT) (97 of 120 isolates, or 80%), and over 70% (86 of 120) of the isolates were resistant to at least three antibiotics in addition to penicillin. (ii) Close to 80% of all isolates were represented by large clusters of bacteria, each with a unique serotype, antibiotype, and chromosomal macrorestriction pattern (determined by pulsed-field gel electrophoresis), as well as unique restriction fragmentation length polymorphisms of the penicillin-binding protein genes pbp1a, pbp2x, and pbp2b. (iii) A large proportion (45 of 120, or 38%) of the strains belonged to two internationally spread epidemic clones of S. pneumoniae, the first expressing capsular type 23F and the second expressing serotype 9. (iv) A unique Bulgarian cluster composed of eight serotype 19F isolates was resistant to tetracycline, SXT, cefotaxime, and extremely high levels of penicillin and erythromycin. Nevertheless, this clone did not react with either the erm or the mef DNA probes, and thus the mechanism of macrolide resistance in this group of PRSP remains to be elucidated.

Acquisition of new capsular genes among clinical isolates of antibiotic-resistant Streptococcus pneumoniae.

Antibiotic-resistant clones of Streptococcus pneumoniae are recognizable through a combination of unique molecular, microbiological, and serological properties. In the course of surveillance of epidemic clones of S. pneumoniae, several isolates were identified that shared the clone-specific pulsed-field gel electrophoretic (PFGE) pattern and antibiotype but expressed serotypes atypical for the particular clone. A selected group of isolates belonging to the Spanish/USA clone but expressing serotypes 19, 14, or 3, instead of the expected serotype 23F, were tested using DNA probes for each of the 18 open reading frames (ORFs) of the 23F capsular locus. In no case were there any 23F-specific genes retained, with the possible exception of genes already known to be common to the capsular loci involved. Analysis of the sequence of the capsular locus of a penicillin-resistant serotype 23F isolate from Mexico showed that part of the cpsA gene of this strain, as well as genes cpsQ and cpsR, had high degrees of identity to the sequence of the homologous genes in isolates expressing serotype 19F. The capsular locus of this Mexican strain may have originated from an in vivo capsular switch event in which the original 19F locus was replaced by 23F-specific capsular genes.

The presence of the tetO gene in a variety of tetracycline-resistant Streptococcus pneumoniae serotypes from Washington State.

Seventy tetracycline-resistant Streptococcus pneumoniae were tested for the presence of tetracycline resistance genes, tetM and tetO, using a polymerase chain reaction (PCR) assay and DNA-DNA hybridization. Seven isolates representing five serotypes (12, 22, 6A, 19F and 23) carried the tetO gene. Five of the isolates were genetically unrelated as judged using pulsed field gel electrophoresis (PFGE) analysis. Two 19F isolates came from the same patient, carried both tetM and tetO genes and had the same PFGE pattern. The other 63 isolates carried only the tetM gene. DNA sequences from three of the tetO-carrying isolates were determined; they showed 91-95% nucleotide sequence identity over 300 nucleotides, and 93-95% amino acid sequence identity over 100 amino acids. The isolates carrying both tetO and tetM genes could transfer the tetM gene into both Enterococcus faecalis and S. pneumoniae recipients, but not the tetO gene. There was no detectable transfer of the tetO gene, by conjugation, from the other five isolates.

An outbreak of multidrug-resistant pneumococcal pneumonia and bacteremia among unvaccinated nursing home residents.

Outbreaks of pneumococcal disease are uncommon and have occurred mainly in institutional settings. Epidemic, invasive, drug-resistant pneumococcal disease has not been seen among adults in the United States. In February 1996, there was an outbreak of multidrug-resistant pneumococcal pneumonia among the residents of a nursing home in rural Oklahoma. We obtained nasopharyngeal swabs for culture from residents and employees. Streptococcus pneumoniae isolates were serotyped and compared by pulsed-field gel electrophoresis. A retrospective cohort study was conducted to identify factors associated with colonization and disease. Pneumonia developed in 11 of 84 residents (13 percent), 3 of whom died. Multidrug-resistant S. pneumoniae, serotype 23F, was isolated from blood and sputum from 7 of the 11 residents with pneumonia (64 percent) and from nasopharygeal specimens from 17 of the 74 residents tested (23 percent) and 2 of the 69 employees tested (3 percent). All the serotype 23F isolates were identical according to pulsed-field gel electrophoresis. Recent use of antibiotics was associated with both colonization (relative risk, 2.3; 95 percent confidence interval, 1.3 to 4.2) and disease (relative risk, 3.6; 95 percent confidence interval, 1.2 to 10.8). Only three residents (4 percent) had undergone pneumococcal vaccination. After residents received pneumococcal vaccine and prophylactic antibiotics, there were no additional cases of pneumonia, and the rates of carriage decreased substantially. In this outbreak a single pneumococcal strain was disseminated among the residents and employees of a nursing home. The high prevalence of colonization with a virulent organism in an unvaccinated population contributed to the high attack rate. Clusters of pneumococcal disease may be underrecognized in nursing homes, and wider use of pneumococcal vaccine is important to prevent institutional outbreaks of drug-resistant S. pneumoniae infection.

Capsular transformation of a multidrug-resistant Streptococcus pneumoniae in vivo.

Several multidrug-resistant (MDR) isolates of Streptococcus pneumoniae recovered from a variety of clinical sources and expressing serotypes 9N, 14, 19F, and 3 could not be distinguished from the capsular type 23 Spanish/USA epidemic clone in antibiotype, pulsed-field gel electrophoretic pattern, and restriction fragment length polymorphism types of their penicillin binding protein genes 1A, 2X, and 2B. When tested in a mouse model of virulence, isolates expressing capsular type 3 were lethal for 100% of infected animals within 2 days after intraperitoneal injection of 10(2) cfu/mouse. In contrast, several capsular type 23F isolates belonging to the MDR Spanish/USA clone and recovered from the same site were not lethal, even when injected at the dose of 10(7) cfu/mouse. These data suggest that the pneumococcal isolates expressing serotypes 9N, 14, 19F, and 3 represent products of in vivo capsular transformation events in which the MDR epidemic capsular type 23F Spanish/USA clone was the recipient.