16Sr Subgroups Research Articles

Molecular Identification and Characterization of Novel Taxonomic Subgroups and New Host Plants in 16SrI and 16SrII Group Phytoplasmas and Their Evolutionary Diversity on Hainan Island, China.

Phytoplasmas are a group of plant prokaryotic pathogens distributed worldwide. To comprehensively reveal the diversity of the pathogens and the diseases they cause on Hainan, a tropical island with abundant biodiversity in China, a survey of phytoplasmal diseases was performed from 2009 to 2022. Herein, molecular identification and genetic analysis were conducted based on the conserved genes of phytoplasmas. The results indicated that phytoplasmas could be detected in 138 samples from 18 host plants among 215 samples suspected to be infected by the pathogens. The phytoplasma strains from 27 diseased samples of 4 host plants belonged to the 16SrI group and the strains from 111 samples of 14 hosts belonged to the 16SrII group. Among them, 12 plants, including important tropical cash crops such as Phoenix dactylifera, cassava, sugarcane, and Piper nigrum, were first identified as hosts of phytoplasmas on Hainan Island. Based on BLAST and iPhyClassifier analyses, seven novel 16Sr subgroups were proposed to describe the relevant phytoplasma strains, comprising the 16SrI-AP, 16SrI-AQ, and 16SrI-AR subgroups within the 16SrI group and the 16SrII-Y, 16SrII-Z, 16SrII-AB, and 16SrII-AC subgroups within the 16SrII group. Genetic variation and phylogenetic analysis indicated that the phytoplasma strains identified in this study and those reported previously on Hainan Island mainly belong to four 16Sr groups (including I, II, V, and XXXII) and could infect 44 host plants, among which the 16SrI and 16SrII groups were the prevalent 16Sr groups associated with 43 host plant species. The diversity of host plants infected by the phytoplasmas made it difficult to monitor and control their related diseases. Therefore, strengthening inspection and quarantine during the introduction and transit of the related phytoplasmal host crops would effectively curb the spread and prevalence of the phytoplasmas and their related lethal diseases.

Molecular Identification of 'Candidatus Phytoplasma malaysianum'-Related Strains Associated with Areca catechu Palm Yellow Leaf Disease and Phylogenetic Diversity of the Phytoplasmas Within the 16SrXXXII Group.

Areca catechu palm is an important cash plant in Hainan Island of China and also in the tropical regions of the world. A. catechu palm yellow leaf (AcYL) disease caused by phytoplasmas is a devastating disease for plant production. In the study, the phytoplasmas associated with the AcYL disease were identified and characterized based on their conserved genes, and genetic variation and phylogenetic relationship of the phytoplasma strains in the 16SrXXXII group were demonstrated. The results indicated that A. catechu palm plants showing yellow leaf symptoms were infected by 'Candidatus Phytoplasma malaysianum'-related strains belonging to the 16SrXXXII-D subgroup. BLAST and multiple sequence alignment analysis based on 16S rRNA and secA genes showed that the AcYL phytoplasmas shared 100% sequence identity and 100% homology with the 'Ca. P. malaysianum'-related strains. Phylogenetic analysis indicated that the AcYL phytoplasmas and 'Ca. P. malaysianum'-related strains belonging to the 16SrXXXII group clustered into one clade with a 100% bootstrap value. Based on computer-simulated digestions, six kinds of restriction fragment length polymorphism patterns within the 16SrXXXII group were obtained, and a novel subgroup in the 16Sr group was recommended to propose and describe the relevant strains in this 16Sr subgroup. To our knowledge, this is the first study to report that A. catechu palm showing yellow leaf symptoms was infected by 'Ca. P. malaysianum'-related strains belonging to the 16SrXXXII group. A novel 16Sr subgroup, 16SrXXXII-F, was proposed based on the systematical analysis of genetic variation of all phytoplasmas within the 16SrXXXII group. The findings of this study will support references for monitoring the epidemiology and developing effective prevention strategies for AcYL disease.

The observation of taxonomic boundaries for the 16SrII and 16SrXXV phytoplasmas using genome-based delimitation.

Within the 16SrII phytoplasma group, subgroups A-X have been classified based on restriction fragment length polymorphism of their 16S rRNA gene, and two species have been described, namely 'Candidatus Phytoplasma aurantifolia' and 'Ca. Phytoplasma australasia'. Strains of 16SrII phytoplasmas are detected across a broad geographic range within Africa, Asia, Australia, Europe and North and South America. Historically, all members of the 16SrII group share ≥97.5 % nucleotide sequence identity of their 16S rRNA gene. In this study, we used whole genome sequences to identify the species boundaries within the 16SrII group. Whole genome analyses were done using 42 phytoplasma strains classified into seven 16SrII subgroups, five 16SrII taxa without official 16Sr subgroup classifications, and one 16SrXXV-A phytoplasma strain used as an outgroup taxon. Based on phylogenomic analyses as well as whole genome average nucleotide and average amino acid identity (ANI and AAI), eight distinct 16SrII taxa equivalent to species were identified, six of which are novel descriptions. Strains within the same species had ANI and AAI values of >97 %, and shared ≥80 % of their genomic segments based on the ANI analysis. Species also had distinct biological and/or ecological features. A 16SrII subgroup often represented a distinct species, e.g., the 16SrII-B subgroup members. Members classified within the 16SrII-A, 16SrII-D, and 16SrII-V subgroups as well as strains classified as sweet potato little leaf phytoplasmas fulfilled criteria to be included as members of a single species, but with subspecies-level relationships with each other. The 16SrXXV-A taxon was also described as a novel phytoplasma species and, based on criteria used for other bacterial families, provided evidence that it could be classified as a distinct genus from the 16SrII phytoplasmas. As more phytoplasma genome sequences become available, the classification system of these bacteria can be further refined at the genus, species, and subspecies taxonomic ranks.

Comparison of Traditional and Next-Generation Approaches for Uncovering Phytoplasma Diversity, with Discovery of New Groups, Subgroups and Potential Vectors.

Simple SummaryPhytoplasmas are bacteria transmitted by insects that cause severe diseases in many plants, including crops, worldwide. Most phytoplasma research focuses on the epidemiology of phytoplasma-associated diseases in agriculture, and relatively few efforts have been made to survey phytoplasma diversity in natural areas. We compared traditional methods for detecting and identifying phytoplasmas with a new method based on next-generation DNA sequencing and found that the next-generation method performs as well, or better, for identifying phytoplasmas in DNA extracted from plant-feeding insects. Using this method, we report several new country/region records and insect associations for known phytoplasmas, three new designated phytoplasma subgroups and three possible new groups.Despite several decades’ effort to detect and identify phytoplasmas (Mollicutes) using PCR and Sanger sequencing focusing on diseased plants, knowledge of phytoplasma biodiversity and vector associations remains highly incomplete. To improve protocols for documenting phytoplasma diversity and ecology, we used DNA extracted from phloem-feeding insects and compared traditional Sanger sequencing with a next-generation sequencing method, Anchored Hybrid Enrichment (AHE) for detecting and characterizing phytoplasmas. Among 22 of 180 leafhopper samples that initially tested positive for phytoplasmas using qPCR, AHE yielded phytoplasma 16Sr sequences for 20 (19 complete and 1 partial sequence) while Sanger sequencing yielded sequences for 16 (11 complete and 5 partial). AHE yielded phytoplasma sequences for an additional 7 samples (3 complete and 4 partial) that did not meet the qPCR threshold for phytoplasma positivity or yielded non-phytoplasma sequences using Sanger sequencing. This suggests that AHE is more efficient for obtaining phytoplasma sequences. Twenty-three samples with sufficient data were classified into eight 16Sr subgroups (16SrI-B, I-F, I-AO, III-U, V-C, IX-J, XI-C, XXXVII-A), three new subgroups (designated as 16SrVI-L, XV-D, XI-G) and three possible new groups. Our results suggest that screening phloem-feeding insects using qPCR and AHE sequencing may be the most efficient method for discovering new phytoplasmas.

First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar.

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Simultaneous detection of coconut lethal yellowing phytoplasmas (group 16SrIV) by real-time PCR assays using 16Sr- and GroEL-based TaqMan probes

Lethal yellowing (LY) represents a serious threat to coconut in Mexico, Central America and the Caribbean islands. It is caused by a phytoplasma of group 16SrIV, and particularly subgroups -A and -D have been the major phytoplasmas affecting coconut palms grown in the southeast of Mexico. Therefore, is important to reliably detect the 16SrIV group of phytoplasmas not only for diagnosis purposes but also to improve the understanding of pathogen-plant-vector pathosystems. The 16S ribosomal operon genes have been particularly used as the targets for probes and primers for universal phytoplasma detection. However, its conservative nature has imposed the search of non-ribosomal genes to support a finer characterization and differentiation of phytoplasmas, particularly those closely related and one alternative has been the GroEL gene for the specific detection of subgroups 16SrIV-A and 16SrIV-D. Sensitive, rapid and reliable singleplex and duplex assays were developed based on real-time PCR (TaqMan) targeting both the GroEL gene and 16S rRNA. The assay performed with higher sensitivity compared to conventional nested-PCR when analysing DNA extracts obtained from LY symptom bearing palms. The LY 16S TaqMan probe assays amplified DNA from both subgroups, while the LY GroEL TaqMan probe assay only amplified DNA from subgroup 16SrIV-A. The duplex TaqMan probe assay is a novel option for the simultaneous detection and quantification of LY phytoplasmas of 16Sr subgroups -A and -D, which are the phytoplasmas that predominantly affect palms in Mexico.

PCR-Based Sequence Analysis on Multiple Genes Other than 16S rRNA Gene for Differentiation of Phytoplasmas.

Differentiation and classification of phytoplasmas have been primarily based on the highly conserved 16S rRNA gene, for which "universal" primers are available. To date, 36 ribosomal (16Sr) groups and more than 150 subgroups have been delineated by RFLP analysis of 16S rRNA gene sequences. However, in recent years, the use of moderately conserved genes as additional genetic markers has enhanced the resolving power in delineating distinct phytoplasma strains among members of some 16Sr subgroups.This chapter describes the methodology of amplification, differentiation, and classification of phytoplasma based on less-conserved non-ribosomal genes, named rp and secY. Actual and virtual RFLP analyses of amplicons obtained by semi-universal or group-specific rp and secY gene-based primers are used for finer differentiation of phytoplasma strains within a given group. The rp and secY gene-based classification not only readily resolves 16Sr subgroups within a given 16Sr group, but also provides finer differentiation of closely related phytoplasma strains within a given 16Sr subgroup.

Standard Detection Protocol: PCR and RFLP Analyses Based on 16S rRNA Gene.

Phytoplasma detection and identification is primarily based on PCR followed by restriction fragment length polymorphism analysis. This method detects and differentiates phytoplasmas including those not yet identified. The protocol describes the application of this method for identification of phytoplasmas at 16S rRNA (16Sr) group and 16Sr subgroup levels on amplicons and also in silico on the same sequences.

Phytoplasmas of sesame and Orosius orientalis are genetically diverse based on 16S rDNA sequencing and PCR-RFLP in Turkey

Sesame phyllody causes significant yield losses mainly in Mediterranean region of Turkey. To detect and identify phytoplasmas of sesame and the cicadellid vector Orosius orientalis, samples were collected during 2011–2013 in Antalya. Nested PCR amplification of the 16S rDNA gave an amplification band of approximately 1246 bp corresponding to the 16Sr F2nR2 region. Identification of the phytoplasmas based on sequence homology revealed presence of the 16Sr groups II (Peanut witches’-broom, PnWB), VI (Clover proliferation, CP) and IX (Pigeon pea witches’-broom, PPWB) in sesame plants. PnWB and CP were detected in O. orientalis. Subgroups were determined by sequencing and PCR-RFLP of the F2nR2 region. 16Sr subgroups II-D, VI-A and IX-C were identified from sesame and II-D and VI-A subgroups from the insect vector. This study shows that phytoplasmas in sesame and O. orientalis are genetically diverse and to the knowledge, VI-A group phytoplasmas from sesame and O. orientalis were characterised molecularly for the first time in Turkey.

Detection and identification of four 16Sr subgroups of phytoplasmas associated with different legume crops in India

Phytoplasma suspected symptoms of little leaf, flat stem, witches’ broom and leaf yellowing were recorded on the four legume species, cowpea (Vigna unguiculata (L.) Walp.), pigeon pea (Cajanus cajan (L.) Millsp.), lentil (Lens culinaris Medikus) and mung bean (Vigna radiata (L.) Wilczek) in the states of Delhi, Uttar Pradesh (UP) and Kerala from 2014 to 2016. DNA specific fragments of approximately 1.3 kb were amplified from symptomatic samples of cowpea, pigeon pea, lentil and mung bean in nested PCR assays by using two sets of universal phytoplasma nested specific primers P1/P7 followed by 3Far/3Rev. No DNA amplifications were observed in any of the non-symptomatic legume samples with same primer pairs. Pair wise sequence comparison, phylogeny and virtual RFLP analysis of 16S rDNA sequences of the four legume species confirmed the association of four different groups and subgroups of phytoplasmas in the present study. The mung bean witches’ broom at Delhi was identified to be associated with strain related to ‘Ca. P. aurantifolia’ (16SrII-D), pigeon pea little leaf at Faizabad, UP with strain related to ‘Ca. P. phoenicium’ (16SrIX-C), lentil witches’ broom at Faizabad, UP with ‘Ca. P. trifolii’ (16SrVI-D) and cow pea flat stem disease at Kerala with ‘Ca. P. cynodontis’ (16SrXIV-A). Association of ‘Ca. P. cynodontis' (16SrXIV-A) infecting cowpea, ‘Ca. P. trifolii’ (16SrVI-D) in lentil and phytoplasmas strain related to ‘Ca. P. phoenicium’ (16SrIX-C) infecting pigeon pea are the new reports to the world.

Phytoplasma classification and phylogeny based on in silico and in vitro RFLP analysis of cpn60 universal target sequences

Phytoplasmas are unculturable, phytopathogenic bacteria that cause economic losses worldwide. As unculturable micro-organisms, phytoplasma taxonomy has been based on the use of the 16S rRNA-encoding gene to establish 16Sr groups and subgroups based on the restriction fragment length polymorphism (RFLP) pattern resulting from the digestion of amplicon (in vitro) or sequence (in silico) with seventeen restriction enzymes. Problems such as heterogeneity of the ribosomal operon and the inability to differentiate closely related phytoplasma strains has motivated the search for additional markers capable of providing finer differentiation of phytoplasma strains. In this study we developed and validated a scheme to classify phytoplasmas based on the use of cpn60 universal target (cpn60 UT) sequences. Ninety-six cpn60 UT sequences from strains belonging to 19 16Sr subgroups were subjected to in silico RFLP using pDRAW32 software, resulting in 25 distinctive RFLP profiles. Based on these results we delineated cpn60 UT groups and subgroups, and established a threshold similarity coefficient for groups and subgroups classifying all the strains analysed in this study. The nucleotide identity among the reference strains, the correspondence between in vitro and in silico RFLP, and the phylogenetic relationships of phytoplasma strains based on cpn60 UT sequences are also discussed.

A new phytoplasma associated with little leaf disease in azalea: multilocus sequence characterization reveals a distinct lineage within the aster yellows phytoplasma group

An azalea little leaf (AzLL) disease characterised by abnormally small leaves, yellowing and witches'-broom growth symptoms was observed in suburban Kunming, southwest China. Transmission electron microscopic observations of single-membrane-bound, ovoid to spherical bodies in phloem sieve elements of diseased plants and detection of phytoplasma-characteristic 16S rRNA gene sequence in DNA samples from diseased plants provided evidence linking the disease to infection by a phytoplasma. Results from restriction fragment length polymorphism, phylogenetic and comparative structural analyses of multiple genetic loci containing 16S rRNA, rpsS, rplV, rpsC and secY genes indicated that the AzLL phytoplasma represented a distinct, new 16Sr subgroup lineage, designated as 16SrI-T, in the aster yellows phytoplasma group. The genotyping also revealed that the AzLL phytoplasma represented new rp and secY gene lineages [rp(I)-P and secY(I)-O, respectively]. Phylogenetic analyses of secY and rp gene sequences allowed clearer distinctions between AzLL and closely related strains than did analysis of 16S rDNA.

Phylogenetic analysis and delineation of phytoplasmas based on secY gene sequences

The secY gene sequence is more variable than that of the 16S rRNA gene. Comparative phylogenetic analyses with 16S rRNA and secY gene sequences from 80 and 83 phytoplasma strains, respectively, were performed to assess the efficacy of these sequences for delineating phytoplasma strains within each 16Sr group. The phylogenetic interrelatedness among phytoplasma taxa inferred by secY gene-based phylogeny was nearly congruent with that inferred by 16S rRNA gene-based phylogeny. Phylogenetic analysis based on the secY gene permitted finer differentiation of phytoplasma strains, however. The secY gene-based phylogeny not only readily resolved 16Sr subgroups within a given 16Sr group, but also delineated distinct lineages irresolvable by 16S rRNA gene-based phylogeny. Such high resolving power makes the secY gene a more useful genetic marker than the 16S rRNA gene for finer differentiation of closely related phytoplasma strains based on RFLP analysis with selected restriction enzymes. Such strains were readily identified by collective secY RFLP patterns. The genetic interrelationships among these strains were determined by pattern similarity coefficients, which coincided with delineations by phylogenetic analysis. This study also revealed two heterogeneous spc operons present in the phytoplasma clade. This latter finding may have significant implications for phytoplasma evolution.

New 16Sr subgroups and distinct single nucleotide polymorphism lineages among grapevine Bois noir phytoplasma populations

AbstractBois noir (BN) is an insect‐transmitted grapevine yellows disease caused by phytoplasmas belonging to the stolbur subgroup 16SrXII‐A. In Italy, increasing prevalence of stolbur phytoplasma strains in vineyards suggests progressive spread of the disease and potential for heavy impacts on the wine industry. In this study, we investigated the genetic diversity of stolbur phytoplasma strains in BN phytoplasma populations. Nucleotide sequences of16S rRNAgenes from stolbur phytoplasma strains affecting vineyards in the Lombardy region of Italy and stolbur phytoplasma 16S rDNA sequences retrieved from GenBank were subjected to virtual restriction fragment length polymorphism analysis. Calculation of virtual restriction similarity coefficients revealed the presence of new subgroups in group 16SrXII (stolbur phytoplasma group). Representative strains of confirmed new subgroups 16SrXII‐F (XII‐F) and XII‐G and tentative new subgroups XII‐A1 through XII‐A19, XII‐H, XII‐I, and XII‐J as well as known subgroup XII‐A were from grapevines; strains representing three additional tentative new subgroups (XII‐K, XII‐L and XII‐M) were from other plant hosts. Nucleotide sequence alignments identified no less than nine genetically distinct 16S rDNA single nucleotide polymorphism lineages from grapevine, indicating a high degree of genetic heterogeneity within BN phytoplasma populations. The findings open new opportunities for in‐depth studies of the distribution of grapevine‐associated 16SrXII phytoplasma strains in weeds, insect vector populations and grapevines from vineyards located in different geographic areas.

Automated RFLP pattern comparison and similarity coefficient calculation for rapid delineation of new and distinct phytoplasma 16Sr subgroup lineages

Phytoplasmas are cell wall-less bacteria that cause numerous diseases in several hundred plant species. During adaptation to transkingdom parasitism in diverse plant and insect hosts, phytoplasma evolution has given rise to widely divergent lineages. Since phytoplasmas cannot be cultured in a cell-free medium, measurable phenotypic characters suitable for conventional microbial classification are mostly inaccessible. Currently, phytoplasma differentiation and classification are mainly dependent on restriction fragment length polymorphism (RFLP) analysis of 16S rRNA gene sequences. Extending our recent efforts in the exploitation of computer-simulated 16S rRNA gene RFLP analysis and virtual gel plotting for rapid classification of phytoplasmas, we have developed a Perl program for automated RFLP pattern comparison and similarity coefficient calculation. This program streamlines virtual RFLP pattern analysis and has led to the establishment of a criterion for phytoplasma 16Sr subgroup classification and to the delineation of new and distinct subgroup lineages in the clover proliferation phytoplasma group (16SrVI).