15-ADON Chemotype Research Articles

Trichothecene mycotoxin profiling of Fusarium graminearum isolates from wheat and maize, and the baseline sensitivity to pydiflumetofen and other fungicides

Fusarium graminearum is the most important pathogen of maize and winter wheat in Canada, resulting in yield loss and mycotoxin contamination. Fungicides are essential to manage F. graminearum in cereal crops. Until pydiflumetofen became commercial, the only available fungicides were triazoles, limiting the potential to manage fungicide resistance. Fusarium graminearum isolates were surveyed from wheat, grain maize and overwintering maize stalks in southern Ontario. Chemotype and the baseline sensitivity to pydiflumetofen were determined in addition to sensitivity to common fungicides used to control F. graminearum. Fusarium graminearum has several strains producing different trichothecenes called chemotypes. In Ontario, 73.3% of the F. graminearum isolates were 3ANX chemotypes producing 7α-hydroxy, 15-deacetylcalonectrin, in addition to 15-acetyldeoxynivalenol and deoxynivalenol; the remaining isolates were 15ADON chemotypes producing only 15-acetyldeoxynivalenol and deoxynivalenol. Chemotype was not affected by isolate source (wheat grain, maize grain, maize stalks) nor by location. All isolates were sensitive to pydiflumetofen and fungicide products containing pydiflumetofen. The mean EC50 for isolates exposed to pydiflumetofen was 0.05 µg mL−1 (range 0.01–0.10 µg mL−1). The mean EC50 for isolates exposed to Miravis®Ace (containing pydiflumetofen and propiconazole), Miravis®Neo 300SE (containing pydiflumetofen, azoxystrobin and propiconazole), Caramba® (containing metconazole), Proline® (containing prothioconazole) and Prosaro (containing prothioconazole and tebuconazole) was 0.06, 0.13, 0.18, 0.05, 3.75 and 0.30 µg mL−1, respectively. These data will be useful in monitoring the development of fungicide resistance.

Genetic Diversity, Mycotoxin Profiles, and Population Structure of Fusarium spp. Associated with Fusarium Head Blight in Georgia, United States.

Fusarium head blight (FHB) has become a limiting factor in soft red winter wheat production in the southeast United States. Recent epidemics have occurred in Georgia, but genetic information on the Fusarium species responsible for FHB is unknown. This study aimed to assess pathogen population structure and genetic diversity, trichothecene profiles, and representative pathogenicity of 196 Fusarium isolates collected from 44 wheat (n = 85) and 53 corn (n = 111) fields in Georgia. Phylogenetic analysis using the translation elongation factor 1-alpha (635 bp) and RNA polymerase second largest subunit (930 bp) sequence data resolved isolates into 185 haplotypes, which represented 12 Fusarium species grouped under five species complexes. F. graminearum with 15-acetyl-deoxynivalenol (15ADON) chemotype (75.6%) and F. incarnatum (57.7%) predominated in wheat and corn, respectively, with a surprisingly higher frequency of nivalenol (NIV) F. graminearum (21.8%). Using nine variable numbers of tandem repeat markers, 82 multilocus genotypes out of 86 F. graminearum isolates were identified and grouped into two genetic clusters, pop1fg (n = 29) and pop2fg (n = 32), as part of the North American populations (NA1 and NA2) but with no chemotype differentiation. F. graminearum populations in Georgia are mostly clonal and might have evolved through at least two introductions from the northeast United States and Canada and local adaptation to maintain high genetic diversity. Pathogenicity of F. graminearum isolates from wheat and corn had high FHB severity (>60%) in wheat, which depicted the risk they can pose towards future FHB outbreaks. Overall, this baseline study provided important information on Fusarium species diversity including F. graminearum associated with FHB in Georgia that will be useful to formulate integrated disease management incorporating improved host resistance and fungicide spray programs.

Insights into Wheat Genotype‒Sphaerodes mycoparasitica Interaction to Improve Crop Yield and Defence against Fusarium graminearum: An Integration of FHB Biocontrol in Canadian Wheat Breeding Programmes.

Fusarium head blight (FHB) is a major threat to wheat crop production and food security worldwide. The creation of resistant wheat cultivars is an essential component of an integrated strategy against Fusarium graminearum, the primary aetiological agent that causes FHB. The results of this study show that the deployment of proto-cooperative interactions between wheat genotypes and mycoparasitic biocontrol agents (BCAs) can improve crop yield and plant resistance in controlling the devastating effects of FHB on wheat agronomic traits. A Fusarium-specific mycoparasite, Sphaerodes mycoparasitica, was found to be compatible with common and durum wheat hosts, thus allowing the efficient control of F. graminearum infection in plants. Four genotypes of wheat, two common wheat, and two durum wheat cultivars with varying FHB resistance levels were used in this greenhouse study. The BCA treatments decreased FHB symptoms in all four cultivars and improved the agronomic traits such as spike number, spike weight, seed weight, plant biomass, and plant height which are vital to grain yield. Conversely, the F. graminearum 3ADON chemotype treatment decreased the agronomic trait values by up to 44% across cultivars. Spike number, spike weight, and seed weight were the most improved traits by the BCA. A more measurable improvement in agronomic traits was observed in durum wheat cultivars compared to common wheat.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

NX Trichothecenes Are Required for Fusarium graminearum Infection of Wheat.

Fusarium graminearum causes Fusarium head blight (FHB) on wheat and barley and contaminates grains with various mycotoxins that are toxic to humans and animals. Deoxynivalenol (DON), a type B trichothecene, is an essential virulence factor that is required for F. graminearum to spread within a wheat head. Recently, novel type A trichothecenes NX-2 and NX-3 (NX) have been found in F. graminearum. NX trichothecenes lack a keto group at the C8 position. To determine if NX trichothecenes play a role similar to that of DON during F. graminearum infection, deletion mutants of TRI5, the first gene for trichothecene biosynthesis, were generated from strains PH-1, NRRL46422, and NRRL44211 (hereafter 44211) representing the 15-acetyl-DON, 3-acetyl-DON, and NX chemotypes. No trichothecene production was detected in any of the Δtri5 mutants in cultures or inoculated wheat heads. FHB symptoms were restricted to the inoculated wheat spikelets when point-inoculated with the Δtri5 mutants, confirming the necessity of NX and DON for FHB spread. Furthermore, whole-head dip inoculations revealed significant reductions in disease and fungal biomass in wheat heads inoculated with 44211Δtri5 compared with 44211. Introduction of the native 44211 TRI5 and a Trichoderma arundinaceum TRI5 ortholog in the 44211Δtri5 mutant complemented trichothecene production in vitro; however, introducing both TRI5 partially restored wild-type levels of NX in infected heads. Our results demonstrate that NX trichothecenes play an important role in Fusarium graminearum initial infection as well as FHB spread. Thus, TRI5 may serve as an ideal target to control plant infection, FHB spread, and mycotoxin production simultaneously. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Effect of Crop Rotation on Fusarium Mycotoxins and Fusarium Species in Cereals in Sichuan Province (China).

The present study was performed to evaluate the effect of crop rotation on Fusarium mycotoxins and species in cereals in Sichuan Province. A total of 311 cereal samples were randomly collected and analyzed from 2018 to 2019 in Sichuan Province. The results of mycotoxin analysis showed that the major trichothecene mycotoxins in Sichuan Province were nivalenol (NIV) and deoxynivalenol (DON), and the mean concentration of total trichothecenes (including NIV, fusarenone X [4ANIV], DON, 3-acetyldeoxynivalenol [3ADON], and 15-acetyldeoxynivalenol [15ADON]) in wheat was significantly higher than that in maize and rice. The concentration of total trichothecenes in the succeeding crops was significantly higher than that in the previous crops. In addition, wheat grown after maize had reduced incidence and concentration of trichothecene mycotoxins compared with that grown after rice, and ratooning rice grown after rice had increased incidence and concentration of trichothecene mycotoxins. Our data indicated that Fusarium asiaticum with the NIV chemotype was predominant in wheat and rice samples, while the number of the NIV chemotypes of F. asiaticum and Fusarium meridionale and the 15ADON chemotype of Fusarium graminearum in maize were almost the same. Although the composition of Fusarium species was affected by crop rotations, there were no differences when comparing the same crop rotation except for the maize-wheat rotation. Moreover, the same species and chemotype of Fusarium strains originated from different crops in various rotations, but there were no significant differences in pathogenicity in wheat and rice. These results contribute to the knowledge of the effect of crop rotation on Fusarium mycotoxins and species affecting cereals in Sichuan Province, which may lead to improved strategies for control of Fusarium mycotoxins and fungal disease in China.

Protocooperative Effect of Sphaerodes mycoparasitica Biocontrol and Crop Genotypes on FHB Mycotoxin Reduction in Bread and Durum Wheat Grains Intended for Human and Animal Consumption

The occurrence of Fusarium Head Blight (FHB) mycotoxins in wheat grains is a major threat to global food safety and security. Humans and animals are continuously being exposed to Fusarium mycotoxins such as deoxynivalenol (DON) and its acetylated derivatives 3ADON and 15ADON through the ingestion of contaminated food or grain-based diet. In this study, a host-specific mycoparasite biocontrol agent (BCA), Sphaerodes mycoparasitica, significantly reduced FHB mycotoxin occurrence in harvested wheat grains from Fusarium graminearum 3ADON chemotype infected plants in greenhouse. Four genotypes of wheat, two common wheat and two durum wheat cultivars with varying FHB resistance levels were used in this study. Principal Coordinate Analysis (PCoA) using Illumina ITS sequences depicted beta diversity changes in Fusarium species indicating that both plant cultivar and BCA treatments influenced the Fusarium species structure and mycotoxin occurrence in grains. Fusarium graminearum complex (cluster A), F. avenaceum and F. acuminatum (cluster B), and F. proliferatum (cluster C) variants were associated with different FHB mycotoxins based on LC-MS/MS analyses. The predominant FHB mycotoxins measured were DON and its acetylated derivatives 3ADON and 15ADON. The BCA reduced the occurrence of DON in grains of all four cultivars (common wheat: 1000-30,000 µg·kg-1.; durum wheat: 600-1000 µg·kg-1) to levels below the Limit of Quantification (LOQ) of 16 µg·kg-1. A relatively higher concentration of DON was detected in the two common wheat genotypes when compared to the durum wheat genotype; however, the percentage reduction in the wheat genotypes was greater, reaching up to 99% with some S. mycoparasitica treatments. Similarly, a higher reduction in DON was measured in susceptible genotypes than in resistant genotypes. This study's findings underscore the potential of a Fusarium-specific S. mycoparasitica BCA as a safe and promising alternative that can be used in conjunction with other management practices to minimize FHB mycotoxins in cereal grain, food and feed intended for human and animal consumption.

Comparison of biomass and deoxynivalenol production of northern European and southern European Fusarium graminearum isolates in the infection of wheat and oat grains

AbstractThe 3ADON chemotype of Fusarium graminearum predominates in northern Europe, whereas the 15ADON chemotype is predominant in central and southern Europe. Therefore, it has been suggested that there are two F. graminearum populations in Europe, which may have been specialized to different host plants. The aim of the present work was to test this hypothesis by comparing southern European isolates (15ADON chemotype) from southern Russia and northern European isolates (3ADON chemotype) from Finland in the infection of grains in wheat cultivar Wellamo and oat cultivar Venla. F. graminearum biomass levels were measured by TaqMan (2018) and SYBR Green (2019) qPCR, while DON levels were measured by chromatographic methods. Most of the qPCR and DON results are supporting the hypothesis that in F. graminearum the 15ADON isolates from southern Russia are more specialized to wheat than the 3ADON isolates from Finland. In oat, there were not as clear differences between the 15ADON and 3ADON isolates, but in 2018 higher F. graminearum DNA levels and in 2019 higher DON and F. graminearum DNA levels were found in oat samples inoculated with 3ADON isolates. Our results are in line with literature according to which F. graminearum DNA and DON levels are also highest in oat in northern Europe, while in southern Europe they are highest in wheat and maize.

Implications of Crop Rotation and Fungicide on Fusarium and Mycotoxin Spectra in Manitoba Barley, 2017-2019.

Fusarium head blight (FHB) is one of the most important diseases of barley in Manitoba province (western Canada), and other major barley producing regions of the world. Little is known about the Fusarium species and mycotoxin spectra associated with FHB of barley in Manitoba. Hence, barley grain samples were collected from 149 commercial fields from 2017 to 2019, along with information on respective cropping history, and analyzed with respect to Fusarium species spectra, abundance, chemotype composition, and mycotoxin profiles. Fusarium poae was the predominant Fusarium species associated with FHB of barley in Manitoba, followed by F. graminearum, and F. sporotrichioides; F. equiseti and F. avenaceum were also detected but at low levels. F. poae strains with the nivalenol (NIV) chemotype and F. graminearum strains with 3-acetyl deoxynivalenol (3-ADON) and 15-acetyl deoxynivalenol (15-ADON) chemotypes were commonly detected in the barley grain samples. Nivalenol (597.7, 219.1, and 412.4 µg kg−1) and deoxynivalenol (DON) (264.7, 56.7, and 65.3 µg kg−1) were the two most prevalent mycotoxins contaminating Manitoba barley in 2017, 2018 and 2019, respectively. A substantially higher DON content was detected in grain samples from barley fields with cereals as a preceding crop compared to canola and flax. Furthermore, F. poae proved less sensitive to four triazole fungicides (metconazole, prothioconazole+tebuconazole, tebuconazole, and prothioconazole) than F. graminearum. Findings from this research will assist barley producers with improved understanding of FHB threat levels and optimizing practices for the best management of FHB in barley.

Trichothecene Genotype Profiling of Wheat Fusarium graminearum Species Complex in Paraguay

Paraguay is a non-traditional wheat-producing country in one of the warmest regions in South America. Fusarium Head Blight (FHB) is a critical disease affecting this crop, caused by the Fusarium graminearum species complex (FGSC). A variety of these species produce trichothecenes, including deoxynivalenol (DON) and its acetylated forms (3-ADON and 15-ADON) or nivalenol (NIV). This study characterized the phylogenetic relationships, and chemotype diversity of 28 strains within FGSC collected from wheat fields across different country regions. Phylogenetic analysis based on the sequence of elongation factor-1α gene (EF-1α) from 28 strains revealed the presence of four species in the FGSC: F. graminearum sensu stricto, F. asiaticum, F. meridionale and F. cortaderiae. Ten strains selected for further analysis revealed that all F. graminearum strains were 15-ADON chemotype, while the two strains of F. meridionale and one strain of F. asiaticum were NIV chemotype. Thus, the 15-ADON chemotype of F. graminearum sensu stricto was predominant within the Fusarium strains isolated in the country. This work is the first report of phylogenetic relationships and chemotype diversity among Fusarium strains which will help understand the population diversity of this pathogen in Paraguay.

Characterization of Fusarium asiaticum and F. graminearum isolates from gramineous weeds in the proximity of rice fields in Korea

AbstractFusarium graminearum species complexes (FGSCs), such as Fusarium asiaticum and F. graminearum, are important pathogens that cause Fusarium head blight (FHB) in several cereal crops worldwide. In this study, we collected 342 gramineous weed samples in the proximity of rice fields from May to June 2018 in Korea. Among the 500 Fusarium isolates from the weed samples, 13 species of Fusarium were identified, and F. asiaticum (41.2%), F. avenaceum (18.0%), F. acuminatum (16.4%) and F. graminearum (14.8%) were the most frequently isolated. The trichothecene genotype analysis showed that 206 F. asiaticum strains consisted of the nivalenol (NIV) genotype (n = 195, 94.7%) and 3‐acetyldeoxynivalenol (3ADON) genotype (n = 11, 5.3%), whereas 74 F. graminearum strains consisted of the 15‐acetyldeoxynivalenol (15ADON) genotype (n = 58, 78.4%) and 3ADON genotype (n = 16, 21.6%). Geographical differences were observed in the FGSC and trichothecene genotype compositions, which appeared host‐dependent between the southern provinces and mid‐eastern provinces. The aggressiveness assessment of FHB showed that the 3ADON chemotype was most aggressive followed by the 15ADON and NIV chemotypes in wheat, while the NIV chemotype was most aggressive followed by the 3ADON and 15ADON chemotypes in rice. The F. asiaticum strains grew slowly and produced fewer conidia and perithecia than the F. graminearum strains, regardless of their chemotypes. The results of this study suggest that F. asiaticum with the NIV chemotype has a host preference for rice, and FHB‐causing pathogens can be harboured in gramineous weeds, which play a role in the dispersal of FHB pathogens to rice and other cereal crops.

First report of Head blight of wheat caused by Fusarium vorosii in Serbia.

The cosmopolitan species Fusarium graminearum Schwabe directly reduces yield, as well as grain quality of cereals, due to its ability to synthesize mycotoxins. Previously it was considered to be one species occurring on all continents. However, phylogenetic analysis employing the GCPSR method (Genealogical Concordance Phylogenetic Species Recognition) revealed the existence of 15 phylogenetic species within what is now recognised as the Fusarium graminearum Species Complex (FGSC) (Sarver et al. 2011). During 1996-2008, a MRIZP collection of FGSC isolates was established and isolates originating from wheat (5), maize (3) and barely (2) were selected for further study. Morphological features including the appearance of colonies and macroconidia (average size 38.5-53.1 × 4.6-5.4 µm, No 50) of all 10 isolates on PDA were consistent with descriptions of F. graminearum (O'Donnell et al. 2004, Leslie and Summerell 2006). Total DNA was isolated from mycelium removed from 7-day old colonies of single-spore isolates grown on PDA using the DNeasy Plant Mini Kit (Qiagen, Hilden). Further identification was based on amplification and sequencing of elongation factor TEF-1α, histone H3 and β-tubulin in both directions, with primers ef1/ef2, H3-1a/H3-1b and T1/T22, respectively (Jacobs et al. 2010). The sequences were deposited in NCBI under accession numbers MF974399 - MF974408 (TEF-1α), MG063783 - MG063792 (β-tubulin) and MF999139 - MF999148 (histone H3). Sequence analysis was performed using BLAST while genetic similarity was calculated using MEGA 6.0 software. Isolate 1339 originating from wheat (collected at the locality of Kikinda in 2006), shared 100% nucleotide identity with TEF-1α (DQ459745), histone H3 (DQ459728) and β-tubulin (DQ459643) of F. vorosii isolate NRRL37605 (Starkey et al. 2007). The remaining nine isolates were identified as F. graminearum as they shared 99% to 100% nucleotide similarity with F. graminearum NRRL 28439 (O'Donnell et al. 2004). Pathogenicity was tested using artificial inoculations of spikes during wheat flowering (Mesterhazy et al. 1999). Thirty classes were inoculated with each isolate, in three replicates. Inoculum was prepared from 7-day colonies on PDA, and 30 ml of a conidia suspension (1x105 conidia/ml) was used. Control plants were inoculated with sterile water. Three weeks after inoculation, typical Fusarium head blight symptoms were visible on inoculated plants, from which all 10 isolates were successfully reisolated. Control spikes remained symptomless. Disease severity was estimated on the 1-7 scale (Blandino et al. 2012). Average pathogenicity of the F. vorosii isolate 1339 was 1.9, and 2.4 -5.1 of F. graminearum isolates. Toxin production was determined using gas chromatography-tandem mass spectrometry. Kernels inoculated with the 10 isolates were ground and tested for the presence of deoxynivalenol (DON) and its acetyl derivatives 3ADON, 15ADON and NIV. F. vorosii isolate 1339 possessed the 15ADON chemotype, as well as eight F. graminearum isolates, while only one F. graminearum isolate was 3ADON chemotype. To date, F. vorosii has only been detected in Hungary on wheat (Toth et al. 2005) and Korea on barley, corn and rice (Lee et al. 2016). This is the first report of F. vorosii in Serbia, which is of great importance, because it indicates the spread of this toxigenic species. Further studies should be focused on determining the distribution, aggressiveness and toxicological profile of F. vorosii.

Assessment of deoxynivalenol and deoxynivalenol derivatives in Fusarium graminearum-inoculated Canadian maize inbreds

The prevalence of maize, wheat and other cereal crops in Ontario, Canada, has led to frequent epidemics of ear rot and head blight disease caused by the broad host pathogen Fusarium graminearum. This fungus produces the trichothecene deoxynivalenol (DON) which is one of the most common mycotoxins contaminating food and feed globally and poses a risk to human and animal health. DON is commonly glycosylated by plant hosts into deoxynivalenol-3-glucoside (DON-3G) as part of a defence mechanism to detoxify and sequester mycotoxins. However, it has been documented that DON-3G can be hydrolyzed in the digestive system of animals, increasing the bioavailability of DON. There is a need for additional documentation of the incidence and ratio of DON-3G to DON in Canadian cereal crops. We investigated the occurrence and relative proportion of DON and modified DON compounds in Canadian-adapted maize germplasm with a wide range of ear rot tolerance. Forty-nine maize inbreds were manually challenged (kernel inoculation) with F. graminearum (15-ADON chemotype) as well as phenotyped for tolerance to Gibberella ear rot (GER) under field conditions. LC/MS was used to analyse 581 maize samples for DON, DON-3G, 15-ADON, and 15-ADON-3G. The DON-3G to DON mean molar ratio ranged from 3.1 to 19.7%. DON content was positively correlated with GER disease severity (r = 0.66, p < 0.01), while the DON-3G:DON molar ratio and disease severity were negatively correlated (r = -0.64, p < 0.001). Thus, GER-tolerant maize genotypes had relatively lower total DON content and higher DON-3G:DON ratios.

Early transcriptomic response of the mycoparasite Sphaerodes mycoparasitica to the mycotoxigenic Fusarium graminearum 3-ADON, the cause of Fusarium head blight

Mycoparasites are an assemblage of biotrophic and necrotrophic fungi that occur on plant pathogenic fungal hosts. Biotrophic mycoparasites are often overlooked in transcriptomic-based biocontrol studies. Sphaerodes mycoparasitica (S.m.) is a specific biotrophic mycoparasite of plant pathogenic Fusarium graminearum (F.g.), a devastating Fusarium head blight (FHB) disease in small-grain cereals. To understand the biotrophic mycoparasitism comprehensively, we performed Illumina RNA-Seq transcriptomic study on the fungus–fungus interaction in vitro. The aim is to identify the transcript-level mechanism related to the biotrophic S.m. mycoparasitism, particularly its ability to effectively control the F.g. 3-ADON chemotype. A shift in the transcriptomic profile of the mycoparasite was triggered in response to its interaction with F.g. during recognition (1.5 days) and colonization (3.5 days) steps. RNA-Seq analysis revealed ~ 30% of annotated transcripts with "function unknown". Further, 14 differentially expressed genes functionally linked to the biotrophic mycoparasitism were validated by quantitative real-time PCR (qPCR). The gene expression patterns of the filamentous haemagglutinin/adhesin/attachment factor as well as cell wall-degrading glucanases and chitinases were upregulated by host interaction. Besides, mycoparasitism-associated antioxidant resistance genes encoding ATP-binding cassette (ABC) transporter(s) and glutathione synthetase(s) were upregulated. However, the thioredoxin reductase was downregulated which infers that this antioxidant gene can be used as a resistance marker to assess S.m. antifungal and antimycotoxigenic activities. The interactive transcriptome of S. mycoparasitica provides new insights into specific mycoparasitism and will contribute to future research in controlling FHB.Graphic

Chemotype and Aggressiveness Evaluation of Fusarium graminearum and Fusarium culmorum Isolates from Wheat Fields in Wisconsin.

Fusarium graminearum commonly causes Fusarium head blight on wheat, barley, rice, and oats. F. graminearum produces nivalenol (NIV) and deoxynivalenol (DON) and forms derivatives of DON based on its acetylation sites. The fungus is profiled into chemotypes based on DON derivative chemotypes (3 acetyldeoxynivalenol [3ADON] chemotype; 15 acetyldeoxynivalenol [15ADON] chemotype), and/or the NIV chemotype. This study assessed the Fusarium population found on wheat and the chemotype profile of the isolates collected from 2016 and 2017 in Wisconsin. F. graminearum was isolated from all locations sampled in both 2016 and 2017. Fusarium culmorum was isolated only from Door County in 2016. Over both growing seasons, 91% of isolates were identified as the 15ADON chemotype, while 9% of isolates were identified as the 3ADON chemotype. Aggressiveness was quantified by area under the disease progress curve (AUDPC). The isolates with the highest AUDPC values were from the highest wheat-producing cropping districts in the state. Deoxynivalenol production in grain and sporulation and growth rate invitro were compared with aggressiveness in the greenhouse. Our results showed that 3ADON isolates in Wisconsin were among the highest in sporulation capacity, growth rate, and DON production in grain. However, there were no significant differences in aggressiveness between the 3ADON and 15ADON isolates. The results of this research detail the baseline frequency and distribution of 3ADON and 15ADON chemotypes observed in Wisconsin. Chemotype distributions within populations of F. graminearum in Wisconsin should continue to be monitored in the future.

Analysis of the Fusarium graminearum Species Complex from Gramineous Weeds Near Wheat Fields in Jiangsu Province, China.

Several weed species are known as alternative hosts of the Fusarium graminearum species complex (FGSC), and their epidemiological significance in Fusarium head blight (FHB) has been investigated; however, scant information is available regarding FGSC occurrence in weeds near Chinese wheat fields. To evaluate the potential role of gramineous weeds surrounding wheat fields in FHB, 306 FGSC isolates were obtained from 210 gramineous weed samples in 2018 in Jiangsu Province. Among them, 289 were Fusarium asiaticum, and the remainder were F. graminearum. Trichothecene genotype and mycotoxin analyses revealed that 74.3% of the F. asiaticum isolates were the 3-acetyldeoxynivalenol (3ADON) chemotype, and the remainder were the nivalenol (NIV) chemotype. Additionally, 82.4% of F. graminearum isolates were the 15-acetyldeoxynivalenol (15ADON) chemotype, and the remainder were the NIV chemotype. FHB severity and trichothecene analysis indicated that F. asiaticum isolates with the 3ADON chemotype were more aggressive than those with the NIV chemotype in wheat. 3ADON and NIV chemotypes of F. asiaticum isolated from weeds and wheat showed no significant differences in pathogenicity in wheat. All selected F. asiaticum isolates produced perithecia, with little difference between the 3ADON and NIV chemotypes. These results highlight the epidemiology of the FGSC isolated from weeds near wheat fields, with implications for reducing FHB inoculum in China.

Simultaneous quantitation of 3ADON and 15ADON chemotypes of DON-producing Fusarium species in Chinese wheat based on duplex droplet digital PCR assay

Pathogens within Fusarium species are the primary agents of Fusarium head blight (FHB) of wheat, which bring about yield reduction and deoxynivalenol (DON) contamination and are of great concern worldwide. DON-producing Fusarium species can be classified into 3-acetyldeoxynivalenol (3ADON) and 15-acetyldeoxynivalenol (15ADON) chemotypes according to the trichothecene metabolites they produce. The detection of these two chemotypes of pathogens is paramount to the successful implementation of disease management strategies and pathogen-related DON forecasting models. In this study, a duplex droplet digital PCR (duplex ddPCR) assay was developed that allowed for the simultaneous quantitation of 3ADON and 15ADON chemotypes of DON-producing Fusarium species. The assay specificity was tested against 30 isolates of target Fusarium species and several non-target Fusarium species that are frequently isolated from wheat in China. Analyzing 90 wheat samples collected from the North China plain and Yangtze River plain demonstrated that the duplex ddPCR assay coupled with magnetic bead-based DNA extraction was competent for investigating composition of 3ADON and 15ADON chemotypes in Chinese wheat. This assay will be useful for monitoring the epidemic and geographic distribution of 3ADON and 15ADON chemotypes of FHB pathogens, which will help with the disease control and DON management.

Transcriptome Alterations of an in vitro-Selected, Moderately Resistant, Two-Row Malting Barley in Response to 3ADON, 15ADON, and NIV Chemotypes of Fusarium graminearum.

Fusarium head blight caused by Fusarium graminearum is a devastating disease of malting barley. Mycotoxins associated with contaminated grain can be transferred from malt to beer and pose a health risk to consumers. In western Canada, F. graminearum has undergone an adaptive shift from 15ADON constituency to dominance by virulent 3ADON-producers; likewise, NIV-producers have established in regions of southern United States. Lack of adapted resistance sources with adequate malting quality has promoted the use of alternative breeding methodologies, such as in vitro selection. We studied the low-deoxynivalenol characteristic of in vitro selected, two-row malting barley variety “Norman” by RNAseq in contrast to its parental line “CDC Kendall,” when infected by 15ADON-, 3ADON-, and NIV-producing isolates of F. graminearum. The current study documents higher mycotoxin accumulation by 3ADON isolates, thereby representing increased threat to barley production. At 72–96-h post infection, significant alterations in transcription patterns were observed in both varieties with pronounced upregulation of the phenylpropanoid pathway and detoxification gene categories (UGT, GST, CyP450, and ABC), particularly in 3ADON treatment. Defense response was multitiered, where differential expression in “Norman” associated with antimicrobial peptides (thionin 2.1, defensing, non-specific lipid-transfer protein) and stress-related proteins, such as late embryogenesis abundant proteins, heat-shock, desiccation related, and a peroxidase (HvPrx5). Several gene targets identified in “Norman” would be useful for application of breeding varieties with reduced deoxynivalenol content.

Differential reaction of hexaploid and tetraploid wheat to Fusarium graminearum chemotypes in a controlled environment

Fusarium head blight (FHB) has a negative impact on cereal food safety, quality and yield. The majority of FHB resistance genes in wheat (Triticum spp.) have been identified based on reaction to Fusarium graminearum, which, in Canada, has two prevalent trichothecene chemotypes, 3-acetyl-deoxyinvalenol (ADON) and 15-ADON. Three hexaploid (Triticum aestivum L.) and four tetraploid (Triticum turgidum L. ssp. durum and Triticum turgidum L. spp. dicoccoides (Korn. ex Asch. & Graebn.) Thell.) wheat genotypes with different genes for resistance and with different reactions to F. graminearum were evaluated in replicated greenhouse trials to determine if the resistance genes currently deployed in Canadian wheat are effective against both the 3-ADON and 15-ADON chemotypes. The development of FHB was rated as disease severity. The genotypes showed differential responses, with a higher level of disease development in the hexaploid wheat genotypes inoculated with the 3-ADON than with the 15-ADON chemotype. The opposite was observed in the tetraploid wheat genotypes. Tetraploid genotype BGRC3487 and a hexaploid genotype ND2710 showed similar resistance to both 3-ADON and 15-ADON chemotypes. These would be effective sources to breed lines resistant to both 3-ADON and 15-ADON chemotypes and reduce FHB risk.

Population Genetic Structure and Chemotype Diversity of Fusarium graminearum Populations from Wheat in Canada and North Eastern United States.

Fusarium head blight (FHB) is a major disease in wheat causing severe economic losses globally by reducing yield and contaminating grain with mycotoxins. In Canada, Fusarium graminearum is the principal etiological agent of FHB in wheat, producing mainly the trichothecene mycotoxin, deoxynivalenol (DON) and its acetyl derivatives (15-acetyl deoxynivalenol (15ADON) and 3-acetyl deoxynivalenol (3ADON)). Understanding the population biology of F. graminearum such as the genetic variability, as well as mycotoxin chemotype diversity among isolates is important in developing sustainable disease management tools. In this study, 570 F. graminearum isolates collected from commercial wheat crops in five geographic regions in three provinces in Canada in 2018 and 2019 were analyzed for population diversity and structure using 10 variable number of tandem repeats (VNTR) markers. A subset of isolates collected from the north-eastern United States was also included for comparative analysis. About 75% of the isolates collected in the Canadian provinces of Saskatchewan and Manitoba were 3ADON indicating a 6-fold increase in Saskatchewan and a 2.5-fold increase in Manitoba within the past 15 years. All isolates from Ontario and those collected from the United States were 15ADON and isolates had a similar population structure. There was high gene diversity (H = 0.803–0.893) in the F. graminearum populations in all regions. Gene flow was high between Saskatchewan and Manitoba (Nm = 4.971–21.750), indicating no genetic differentiation between these regions. In contrast, less gene flow was observed among the western provinces and Ontario (Nm = 3.829–9.756) and USA isolates ((Nm = 2.803–6.150). However, Bayesian clustering model analyses of trichothecene chemotype subpopulations divided the populations into two clusters, which was correlated with trichothecene types. Additionally, population cluster analysis revealed there was more admixture of isolates among isolates of the 3ADON chemotypes than among the 15ADON chemotype, an observation that could play a role in the increased virulence of F. graminearum. Understanding the population genetic structure and mycotoxin chemotype variations of the pathogen will assist in developing FHB resistant wheat cultivars and in mycotoxin risk assessment in Canada.