10-base Pair Research Articles

Dizygotic twins with prolonged jaundice and microcytic, hypochromic, hemolytic anemia with pyropoikilocytosis

Dizygotic twin males, born at 34 weeks gestation, had prolonged jaundice, microcytic, hypochromic anemia, FABarts hemoglobin, elevated end-tidal CO, and blood films consistent with hereditary pyropoikilocytosis. DNA sequencing revealed both had a heterozygous alpha spectrin (SPTA1) mutation (c.460_462dup) inherited from their asymptomatic mother, plus a 3-base pair duplication in alpha globin (HBA2) (c.364_366dupGTG) inherited from their asymptomatic father.

DFNA5 (GSDME) c.991-15_991-13delTTC: Founder Mutation or Mutational Hotspot?

Deafness due to mutations in the DFNA5 gene is caused by the aberrant splicing of exon 8, which results in a constitutively active truncated protein. In a large family of European descent (MORL-ADF1) segregating autosomal dominant nonsyndromic hearing loss, we used the OtoSCOPE platform to identify the genetic cause of deafness. After variant filtering and prioritization, the only remaining variant that segregated with the hearing loss in the family was the previously described c.991-15_991-13delTTC mutation in DFNA5. This 3-base pair deletion in the polypyrimidine of intron 7 is a founder mutation in the East Asian population. Using ethnicity-informative markers and haplotype reconstruction within the DFNA5 gene, we confirmed family MORL-ADF1 is of European ancestry, and that the c.991-15_991-13delTTC mutation arose on a unique haplotype, as compared to that of East Asian families segregating this mutation. In-depth audiometric analysis showed no statistical difference between the audiometric profile of family MORL-ADF1 and the East Asian families. Our data suggest the polypyrimidine tract in intron 7 may be a hotspot for mutations.

Human leukocyte antigen-G donor-recipient matching of the 14-base pair polymorphism protects against cancer after heart transplant

After a transplant, cancer is a leading cause of morbidity and mortality. Human leukocyte antigen-G (HLA-G)-an immune checkpoint molecule-reduces allograft rejection by dampening host immune responses. Reports suggest malignant cells utilize HLA-G to evade the immune system and promote cancer development. Our objective was to evaluate HLA-G donor-recipient polymorphism matching and development of cancer after a heart transplant. Recipients (n = 251) and corresponding donors (n = 196) were genotyped retrospectively to identify HLA-G polymorphisms in the 5' regulatory (-725, -201), 3' untranslated (+3,197, +3,187, +3,142, 14-base pair insertion-deletion polymorphism [14-bp indel]) and coding regions (Haplotypes I-VI). Associations between donor-recipient polymorphism matching and development of cancer were assessed through multivariate proportional hazard regression models. Recipient and donor (48.2 ± 12.1 and 35.5 ± 14.3 years, respectively) mean follow-up was 7.2 ± 4.6 years. Overall, 42 (16.7%) recipients developed de novo post-transplant cancer. 14-bp polymorphism matching significantly reduced the proportion of cancer, revealing an independent protective effect (hazard ratio [95% CI]: 0.26 [0.10-0.75]; p = 0.012). Recipients with the 14-bp insertion sequence, whether homozygous or heterozygous, had a lower proportion of cancer (p > 0.008), matching the INS sequence (INS/INS and INS/DEL) protected against cancer (p = 0.002). No differences were seen between matched vs unmatched cohorts regarding all donor-recipient pre-transplant and post-transplant characteristics. No other polymorphisms showed significant associations. We investigated donor-recipient HLA-G polymorphism matching and development of cancer following a heart transplant. Donor-recipient 14-bp matching was an independent protective factor against cancer development. HLA-G may have a role in therapeutic and diagnostic strategies against cancer. Identifying relevant HLA-G polymorphisms may warrant alterations in immunotherapy to reduce post-transplant cancer risk.

Unknown Areas of Activity of Human Ribonuclease Dicer: A Putative Deoxyribonuclease Activity.

The Dicer ribonuclease plays a crucial role in the biogenesis of small regulatory RNAs (srRNAs) by processing long double-stranded RNAs and single-stranded hairpin RNA precursors into small interfering RNAs (siRNAs) and microRNAs (miRNAs), respectively. Dicer-generated srRNAs can control gene expression by targeting complementary transcripts and repressing their translation or inducing their cleavage. Human Dicer (hDicer) is a multidomain enzyme comprising a putative helicase domain, a DUF283 domain, platform, a PAZ domain, a connector helix, two RNase III domains (RNase IIIa and RNase IIIb) and a dsRNA-binding domain. Specific, ~20-base pair siRNA or miRNA duplexes with 2 nucleotide (nt) 3’-overhangs are generated by Dicer when an RNA substrate is anchored within the platform-PAZ-connector helix (PPC) region. However, increasing number of reports indicate that in the absence of the PAZ domain, binding of RNA substrates can occur by other Dicer domains. Interestingly, truncated variants of Dicer, lacking the PPC region, have been found to display a DNase activity. Inspired by these findings, we investigated how the lack of the PAZ domain, or the entire PPC region, would influence the cleavage activity of hDicer. Using immunopurified 3xFlag-hDicer produced in human cells and its two variants: one lacking the PAZ domain, and the other lacking the entire PPC region, we show that the PAZ domain deletion variants of hDicer are not able to process a pre-miRNA substrate, a dsRNA with 2-nt 3ʹ-overhangs, and a blunt-ended dsRNA. However, the PAZ deletion variants exhibit both RNase and DNase activity on short single-stranded RNA and DNAs, respectively. Collectively, our results indicate that when the PAZ domain is absent, other hDicer domains may contribute to substrate binding and in this case, non-canonical products can be generated.

Unusual phenotype in patients with a hypomorphic mutation in the DCLRE1C gene: IgG hypergammaglobulinemia with IgA and IgE deficiency

The nuclease Artemis is a enzyme for V(D)J recombination allowing for the creation of T and B lymphocytes as well as for the repair of radiation-induced DNA double strand breaks encoded by the DCLRE1C gene. Artemis-null mutations are a known cause of severe combined immunodeficiencies (SCIDs) with radiosensitivity. Hypomorphic mutations in Artemis have been reported to cause a “leaky SCID"” phenotype, typically with hypogammaglobulinemia. We present four patients, all harboring the same unique hypomorphic mutation in the DCLRE1C gene, an 8-base pair insertion (c.1299_1306dup, p.Cys436*) presenting with a relatively mild phenotype including pulmonary infectious EBV-related lymphoproliferative diseases, an autoimmune phenomenon. Non-typical findings of IgG hypergammaglobulinemia accompanied by IgA and IgE deficiency were recorded in all patients. The typical viral, fungal, and opportunistic infections were absent, and patients reached a relatively old age.

DRD4 48\u2009bp multiallelic variants as age-population-specific biomarkers in attention-deficit/hyperactivity disorder

The identification of biomarkers to support the diagnosis and prediction of treatment response for attention-deficit/hyperactivity disorder (ADHD) is still a challenge. Our previous works highlighted the DRD4 (dopamine receptor D4) as the best potential genetic marker for childhood diagnosis and methylphenidate (MPH) response. Here, we aimed to provide additional evidence on biomarkers for ADHD diagnosis and treatment response, by using more specific approaches such as meta-analytic and bioinformatics tools. Via meta-analytic approaches including over 3000 cases and 16,000 controls, we demonstrated that, among the different variants studied in DRD4 gene, the 48-base pair, Variable Tandem Repeat Polymorphism, VNTR in exon 3 showed an age/population-specificity and an allelic heterogeneity. In particular, the 7R/“long” allele was identified as an ADHD risk factor in European-Caucasian populations (d = 1.31, 95%CI: 1.17–1.47, Z = 4.70/d = 1.36, 95%CI: 1.20–1.55, Z = 4.78, respectively), also, from the results of last meta-analysis, linked to the poor MPH efficacy. The 4R/“short” allele was a protective factor in European-Caucasian and South American populations (d = 0.83, 95%CI: 0.75–0.92, Z = 3.58), and was also associated to positive MPH response. These results refer to children with ADHD. No evidence of such associations was detected for adults with persistent ADHD (data from the last meta-analysis). Moreover, we found evidence that the 4R allele leads to higher receptor expression and increased sensitivity to dopamine, as compared with the 7R allele (d = 1.20, 95%CI: 0.71–1.69, Z = 4.81), and this is consistent with the ADHD protection/susceptibility effects of the respective alleles. Using bioinformatics tools, based on the latest genome-wide association (GWAS) meta-analysis of the Psychiatry Genomic Consortium (PGC), we demonstrated that the 48 bp VNTR is not in Linkage Disequilibrium with the DRD4 SNPs (Single Nucleotide Polymorphisms), which were not found to be associated with ADHD. Moreover, a DRD4 expression downregulation was found in ADHD specific brain regions (Putamen, Z score = −3.02, P = 0.00252). Overall, our results suggest that DRD4 48 bp VNTR variants should be considered as biomarkers to support the diagnosis of ADHD and to predict MPH response, although the accuracy of such a biomarker remains to be further elucidated.

Dact2 is involved in the regulation of epithelial-mesenchymal transition

Dishevelled-associated antagonist of beta-catenin 2 (Dact2) is involved in the regulation of intracellular signaling pathways during development. It negatively regulates the Nodal signaling pathway, possibly by promoting lysosomal degradation of Nodal receptors such as TGFBR1, and plays an inhibitory role during the re-epithelialization of skin wounds by attenuating transforming growth factor-β signaling. Dact2 is known to act as a functional tumor suppressor in colon cancer; reduced Dact2 can promote liver cancer progression and suppress gastric cancer proliferation, invasion, and metastasis by inhibiting Wnt signaling. Zebrafish is used as a model of cancer biology because it shows similar tumorigenesis and morphogenesis as in humans and gene manipulation in this organism is possible. This study was performed to explore phenotypic changes in Dact2 knockout zebrafish and investigate the function of Dact2. A 10-base pair deletion Dact2 knockout zebrafish was prepared using the CRISPR-Cas9 genome editing system. Dact2 knockout enhanced the expression of the MMP2 and MMP9 genes, which are related to tumor invasion and migration, and the Snail, VEGF, and ZEB genes, which are related to epithelial-mesenchymal transition (EMT). The absence of Dact2 also resulted in hyperplasia of the gastrointestinal epithelium, fibrosis in the pancreas and liver, increased proliferation of the pancreatic and hepatic bile ducts, and invasive proliferation into the pancreas. A wound healing assay confirmed that the absence of Dact2 enhanced EMT, thus accelerating wound healing. This study suggests that a loss of function of Dact2 impacts EMT-related gene regulation and tumor generation in a zebrafish knockout model, which is a useful model for exploring the mechanisms of these processes.

Early-onset Paget's disease of bone in a Mexican family caused by a novel tandem duplication (77dup27) in TNFRSF11A that encodes RANK.

Four heterozygous in-frame tandem duplications of different lengths in TNFRSF11A, the gene that encodes receptor activator of nuclear factor κB (RANK), constitutively activate RANK and lead to high turnover skeletal disease. Each duplication elongates the signal peptide of RANK. The 18-base pair (bp) duplication at position 84 (84dup18) causes familial expansile osteolysis (FEO), the 15-bp duplication at position 84 (84dup15) causes expansile skeletal hyperphosphatasia (ESH), the 12-bp duplication at position 90 (90dup12) causes panostotic expansile bone disease (PEBD), and the 27-bp duplication causes early-onset Paget's disease of bone (PDB2). The severity of the associated skeletal disease seems inversely related to the duplication's length. Additional 15- and 18-bp duplications of TNFRSF11A fit this pattern. Herein, we delineate the skeletal disease of a middle-aged man of Mexican descent who we found to harbor a novel 27-bp tandem duplication at position 77 (77dup27) of TNFRSF11A. His disorder shares features, particularly hand involvement, with the single Japanese (75dup27) and Chinese (78dup27) kindreds with PDB2 (PDB2Jpn and PDB2Chn, respectively). However, his distinct hearing loss developed later in adulthood compared to the other 27-bp families. He reported no morbidities during childhood, but in his late 20s developed unexplained tooth loss, low-trauma fractures, post-operative hypercalcemia, and painless enlargement of his fingers. Biochemical studies showed elevated serum alkaline phosphatase (ALP), bone-specific ALP, C-telopeptide, and osteocalcin consistent with rapid bone remodeling. Radiologic imaging revealed remarkably lucent bones with vertebral compression fractures, calvarial lucencies, and thinned long bone cortices. DXA showed extremely low bone mineral density. His disorder genetically and phenotypically fits best with PDB2 and can be called PDB2Mex.

Determination of the Relationship Between Craving and 4-repeat Allele of DRD4 Gene Polymorphism in the Early Withdrawal Period of Alcohol Use Disorders.

Alcohol use disorder (AUD) is a disease with chronic relapses. Risk factors of craving, which is thought to be one of the predictors of relapse, have been studied for a long time. The DRD4 gene is located on chromosome 11p and has a 48-base pair variable number of tandem repeat (VNTR) polymorphisms in the 3rd exon. This study aimed to investigate if a relationship existed between craving and DRD4 VNTR polymorphism and to determine the predictors of craving. A total of 125 patients with AUD were included in the study. The sociodemographic data form, the Michigan Alcoholism Screening Test (MAST), the Obsessive Compulsive Drinking Scale (OCDS), and the Penn Alcohol Craving Scale (PACS) were applied to the patients. Polymerase chain reaction (PCR) was used to determine the DRD4 VNTR variant of all participants in the peripheral blood sample. In the 4R/4R homozygous group, it was found that the age at first alcohol use was higher and the scores of the OCDS on the seventh day were lower, but this relationship could not be demonstrated in further statistical analyses. In the stepwise linear regression model, the age at first alcohol use, MAST score, duration of AUD, and delirium tremens history were found to be the predictors of craving. DRD4 VNTR polymorphism does not play a role as a predictor of craving. A decrease in age at first alcohol use, an increase in the MAST score, and the presence of delirium tremens were found to be the predictors of craving among the participants of this study.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

BackgroundSynpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.MethodsWe used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.ResultsOur results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.ConclusionBased on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Hypervirulent clade 2, ribotype 019/sequence type 67 Clostridioides difficile strain from Japan

BackgroundClostridioides difficile ribotype (RT) 019/sequence type (ST) 67 strains belong to a hypervirulent lineage closely related to RT027/ST1; however, limited data are available for hypervirulent clade 2 lineages in Japan. Herein, we report the draft genome of a C. difficile strain B18-123 belonging to clade 2, RT019/ST67 for the first time in Japan.ResultsThe pathogenicity locus carried by B18-123 (19.6 kb) showed higher homology (97.29% nucleotide identity) with strain R20291 (RT027/ST1) than the reference strain 630 (RT012/ST54), and B18-123 harbored 8-nucleotide substitutions in tcdC. However, it did not contain an 18-base pair (bp) deletion or a single-bp deletion at position 117 in tcdC, which was identified in the previous strain R20291. A cytotoxicity assay revealed similar cytotoxicity levels between strains B18-123 and ATCC BAA-1870 (RT027/ST1). The B18-123 strain was found to be susceptible to metronidazole and vancomycin.ConclusionOur findings contribute to the further understanding of the characteristics of hypervirulent clade 2 including RT019/ST67 lineages.

Enzyme-Mediated Endogenous and Bioorthogonal Control of a DNAzyme Fluorescent Sensor for Imaging Metal Ions in Living Cells.

Bioorthogonal control of metal-ion sensors for imaging metal ions in living cells is important for understanding the distribution and fluctuation of metal ions. Reported here is the endogenous and bioorthogonal activation of a DNAzyme fluorescent sensor containing an 18-base pair recognition site of a homing endonuclease (I-SceI), which is found by chance only once in 7×1010 bp of genomic sequences, and can thus form a near bioorthogonal pair with I-SceI for DNAzyme activation with minimal effect on living cells. Once I-SceI is expressed inside cells, it cleaves at the recognition site, allowing the DNAzyme to adopt its active conformation. The activated DNAzyme sensor is then able to specifically catalyze cleavage of a substrate strand in the presence of Mg2+ to release the fluorophore-labeled DNA fragment and produce a fluorescent turn-on signal for Mg2+ . Thus I-SceI bioorthogonally activates the 10-23 DNAzyme for imaging of Mg2+ in HeLa cells.

The Basis for Strain-Dependent Rat Aldehyde Dehydrogenase 1A7 (ALDH1A7) Gene Expression.

Aldehyde hydrogenases (ALDHs) belong to a large gene family involved in oxidation of both endogenous and exogenous compounds in mammalian tissues. Among ALDHs, the rat ALDH1A7 gene displays a curious strain dependence in phenobarbital (PB)-induced hepatic expression: the responsive RR strains exhibit induction of both ALDH1A7 and CYP2B mRNAs and activities, whereas the nonresponsive rr strains show induction of CYP2B only. Here, we investigated the responsiveness of ALDH1A1, ALDH1A7, CYP2B1, and CYP3A23 genes to prototypical P450 inducers, expression of nuclear receptors CAR and pregnane X receptor, and structure of the ALDH1A7 promoter in both rat strains. ALDH1A7 mRNA, associated protein and activity were strongly induced by PB and modestly induced by pregnenolone 16α-carbonitrile in the RR strain but negligibly in the rr strain, whereas induction of ALDH1A1 and P450 mRNAs was similar between the strains. Reporter gene and chromatin immunoprecipitation assays indicated that the loss of ALDH1A7 inducibility in the rr strain is profoundly linked with a 16-base pair deletion in the proximal promoter and inability of the upstream DNA sequences to recruit constitutive androstane receptor-retinoid X receptor heterodimers. SIGNIFICANCE STATEMENT: Genetic variation in rat ALDH1A7 promoter sequences underlie the large strain-dependent differences in expression and inducibility by phenobarbital of the aldehyde dehydrogenase activity. This finding has implications for the design and interpretation of pharmacological and toxicological studies on the effects and disposition of aldehydes.

A 14-bp functional deletion within the CMTM2 gene is significantly associated with litter size in goat

CKLF-like MARVEL transmembrane domain-containing 2 (CMTM2) plays an important role in animal reproduction, and abnormal CMTM2 expression leads to spermatogenesis disorders. This study was conducted to assess the role of CMTM2 in goat reproduction by investigating an insertion/deletion (indel) variation and its effect on litter size, and to reveal its functional mechanism. A 14-base pair (bp) indel was found at position −861 to −848 nt of the CMTM2 promoter in 1131 female Shaanbei white cashmere goats. Association analyses revealed that the 14-bp indel in dams was significantly correlated with the size of the first litter (P = 0.013), with the 14-bp deletion significantly decreasing litter size. Moreover, litter size at first kidding was significantly correlated with genotype frequencies (P = 0.019). Expression of the goat CMTM2 gene was detected in testes and ovaries. In male, CMTM2 was increased after the initiation of meiosis in the developing testis. In female, CMTM2 expression was higher in ovary from multiple prolific goats at first kidding compared to non-prolific goats. Moreover, both in testis after initiation of meiosis and in ovary, the homozygous 14-bp inserted genotype II was associated with increased CMTM2 expression compared to the heterozygous genotype ID (P < 0.05). To further explore whether the 14-bp indel was located in the core promoter activity region of the CMTM2 promoter, the five recombinant plasmids pGL3-pro1 (−1756 to +83), pGL3-pro2 (−1200 to +83), pGL3-pro3 (−763 to +83), pGL3-pro4 (−496 to +83), and pGL3-pro5 (−205 to +83) were co-transfected with pRL-TK into HEK293T and GC-1 cells. A luciferase reporter assay showed that the pGL3-pro2 and pGL3-pro5 vectors produced significantly stronger luminescence than the other vectors. Interestingly, the 14-bp indel locus was included in the pGL3-pro2 plasmid, suggesting that the indel was functional. Subsequently, the two recombinant plasmids pGL3-pro2-inserted-allele and pGL3-pro2-deleted-allele were co-transfected with pRL-TK into HEK293T and GC-1 cells, respectively. The luciferase reporter assay demonstrated that the deleted allele of CMTM2 showed significantly lower luminescence activity than the inserted allele (P < 0.05), which corresponded to a decrease in litter size in the deletion-deletion genotype. Therefore, our results suggest that a 14-bp deletion in the promoter region of CMTM2 is significantly correlated with litter size in goats; this marker seems promising for breeding selection for improving economically important traits in goats.

Establishment and Characterization of Three Afatinib-resistant Lung Adenocarcinoma PC-9 Cell Lines Developed with Increasing Doses of Afatinib.

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in most countries. The discovery of "oncogenic driver mutations," such as epidermal growth factor receptor (EGFR)-activating mutations, and subsequent development of molecular targeted agents of EGFR tyrosine kinase inhibitors (TKIs) (gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib) have dramatically altered lung cancer treatment in recent decades. However, these drugs are still not effective in patients with non-small cell lung cancer (NSCLC) carrying EGFR-activating mutations. Following acquired resistance, the systemic progression of NSCLC remains a significant obstacle in treating patients with EGFR mutation-positive NSCLC. Here, we present a stepwise dose escalation method for establishing three independent acquired afatinib-resistant cell lines from NSCLC PC-9 cells harboring EGFR-activating mutations of 15-base pair deletions in EGFR exon 19. Methods for characterizing the three independent afatinib-resistance cell lines are briefly presented. The acquired resistance mechanisms to EGFR TKIs are heterogeneous. Therefore, multiple cell lines with acquired resistance to EGFR-TKIs must be examined. Ten to twelve months are required to obtain cell lines with acquired resistance using this stepwise dose escalation approach. The discovery of novel acquired resistance mechanisms will contribute to the development of more effective and safe therapeutic strategies.

A common indel polymorphism of the Desmoglein-2 (DSG2) is associated with sudden cardiac death in Chinese populations

Sudden cardiac death (SCD) is referred to as sudden and unexpected death caused by cardiovascular diseases, in which a person preexisted heart disease or not. Compelling evidence indicates that SCD etiology have been predominantly affected by host genetic factors. However, how genetic variants play roles in the inherited risk component of SCD are still largely unknown. It has been reported that Desmoglein-2 (DSG2) mutations might be related to sudden death. In the present study, we used a candidate gene approach to investigate the associations between rs397729601 (a 2-base pair indel polymorphism) mapping to the 3′UTR of DSG2 with the risk of SCD. It is shown by logistic regression analysis that the risk of SCD has been significantly increased by the deletion allele of rs397729601 [odds ratio (OR)=1.51; 95% confidence interval (CI)=1.12–2.05; P=0.00559]. Additional genotype-phenotype analysis was performed to evaluate the mRNA level, revealing that human myocardium tissues with the deletion allele showed higher expression of DSG2. Dual luciferase activity analysis was conducted in an in vitro reporter gene system, suggesting that DSG2 expression could be regulated by rs397729601 which interrupted the binding of miR-933-3p with DSG2. We concluded that rs397729601 may affect the expression of DSG2 through miR-933-3p regulation, contributing to SCD susceptibility. Thus, rs397729601 may be used as a potential marker for molecular diagnosis and genetic counseling of SCD. Our findings need to be validated through replication and further functional studies.

Parsing out the role of dopamine D4 receptor gene (DRD4) on alcohol-related phenotypes: A meta-analysis and systematic review.

Genetics account for moderate variation of individual differences in developing alcohol use disorder (AUD), but it is unclear which genetic variations contribute to AUD risk. One candidate gene investigated due to its association with AUD is the dopamine D4 receptor gene (DRD4), which contains a 48-base pair variable number tandem repeat (VNTR) in exon 3 of its coding region. To date, no quantitative synthesis of the published literature on the effects of DRD4 VNTR variation on alcohol-related phenotypes has been conducted. MEDLINE, Embase, Web of Science, and PsycInfo were searched for studies that reported on alcohol craving, alcohol consumption, severity of AUD, and case-control (AUD versus no diagnosis of AUD) studies in DRD4L (seven repeats or more) carriers compared with DRD4S (six repeats or less) homozygotes. Random-effects meta-analysis was used for all analyses. A pooled sample size of 655 to 13,360 of 28 studies were included. Compared with DRD4S homozygotes, DRD4L carriers had increased number of drinking days (SMD: 0.205; 95% CI: 0.008 to 0.402), binge drinking days (SMD: 0.217; 95% CI: 0.0532 to 0.380), and severity of AUD (SMD: 0.143; 95% CI: 0.028to0.259). There was no difference between DRD4 VNTR genotypes on drinks per drinking day, largest number of drinks per day/occasion, and case-control analysis. It was not possible to conduct a meta-analysis of the craving data, but a systematic review of this literature found mixed results on DRD4 VNTR genotype effect. The present meta-analysis suggests DRD4 VNTR variation may be a risk factor for problematic alcohol use. Our findings are limited, however, by the absence of ancestry data from studies included in our analysis, precluding our ability to adjust for population stratification. Due to the likelihood of type I error in candidate gene approaches, our work highlights the critical need for studies with larger and more inclusive samples that account for sex and genetic ancestry to fully understand this relationship.

Two-tiered electrical detection, purification, and identification of nucleic acids in complex media

We demonstrate a two-tiered platform for electrically detecting, purifying, and distinguishing mismatched nucleic acid sequences (DNA and RNA) in complex biological liquid samples. The first tier uses a nanoporous gold (np-Au) for the electrochemical detection and subsequent purification of nucleic acids. The sieve-like structure of np-Au blocks the permeation of large biomolecules and allows for selective transport of nucleic acids to the sensing surface, thereby obviating the need for prior purification steps. The second tier utilizes single-molecule electrical conductance measurements to verify sequence information and identify the presence of mismatches between the DNA probe and the RNA target. This step utilizes the single-molecule break junction approach to measure samples eluted from the first-tier to reduce the possibility of false positives from similar target sequences. In this report, the two-tiered approach is employed to detect a 15-base pair (bp) E. coli. RNA sequence in blood, and is further expanded to differentiate between the perfectly-matched case and partial mismatches of the DNA:RNA hybrids.

Altered C10 domain in cardiac myosin binding protein-C results in hypertrophic cardiomyopathy.

A 25-base pair deletion in the cardiac myosin binding protein-C (cMyBP-C) gene (MYBPC3), proposed to skip exon 33, modifies the C10 domain (cMyBP-CΔC10mut) and is associated with hypertrophic cardiomyopathy (HCM) and heart failure, affecting approximately 100 million South Asians. However, the molecular mechanisms underlying the pathogenicity of cMyBP-CΔC10mutin vivo are unknown. We hypothesized that expression of cMyBP-CΔC10mut exerts a poison polypeptide effect leading to improper assembly of cardiac sarcomeres and the development of HCM. To determine whether expression of cMyBP-CΔC10mut is sufficient to cause HCM and contractile dysfunction in vivo, we generated transgenic (TG) mice having cardiac-specific protein expression of cMyBP-CΔC10mut at approximately half the level of endogenous cMyBP-C. At 12 weeks of age, significant hypertrophy was observed in TG mice expressing cMyBP-CΔC10mut (heart weight/body weight ratio: 4.43 ± 0.11 mg/g non-transgenic (NTG) vs. 5.34 ± 0.25 mg/g cMyBP-CΔC10mut, P < 0.05). Furthermore, haematoxylin and eosin, Masson's trichrome staining, as well as second-harmonic generation imaging revealed the presence of significant fibrosis and a greater relative nuclear area in cMyBP-CΔC10mut hearts compared with NTG controls. M-mode echocardiography analysis revealed hypercontractile hearts (EF: 53.4%±2.9% NTG vs. 66.4% ± 4.7% cMyBP-CΔC10mut; P < 0.05) and early diastolic dysfunction (E/E': 28.7 ± 3.7 NTG vs. 46.3 ± 8.4 cMyBP-CΔC10mut; P < 0.05), indicating the presence of an HCM phenotype. To assess whether these changes manifested at the myofilament level, contractile function of single skinned cardiomyocytes was measured. Preserved maximum force generation and increased Ca2+-sensitivity of force generation were observed in cardiomyocytes from cMyBP-CΔC10mut mice compared with NTG controls (EC50: 3.6 ± 0.02 µM NTG vs. 2.90 ± 0.01 µM cMyBP-CΔC10mut; P < 0.0001). Expression of cMyBP-C protein with a modified C10 domain is sufficient to cause contractile dysfunction and HCM in vivo.

The Impact of HLA-G 3′UTR Polymorphisms in Breast Cancer in a Tunisian Population

ABSTRACTHuman leukocyte antigens G and E (HLA-G and HLA-E) are nonclassical major histocompatibility complex (MHC) class I molecules. These molecules play an important role in immune surveillance by inhibiting natural killer and cytotoxic T cells responsible for immune escape. The expression of HLA-G and HLA-E has been associated with several diseases including tumor. The main objective of the study is to evaluate the impact of three HLA-G 3ʹUTR potential polymorphisms: +3187 A > G (rs9380142), +3142 G > C (rs1063320), +2960 14-base pair (bp) Insertion/Deletion (Ins/Del) (rs66554220), and the HLA-E*01:01/01:03 A > G (rs1264457) polymorphism in Tunisian breast cancer population. A total of 355 patients and 381 controls were genotyping for HLA-G and HLA-E polymorphisms using a Taq Man assay. +3142 C allele and +3142 C/C genotype were significantly associated with increased risk of breast cancer (p = 0.00002; OR = 1.58; 95% CI = 27–1.97) (49% versus 35%; p = 0.0001; OR = 1.79; 95% CI = 1.32–2.44). In addition, Del allele and the homozygous state for Del/Del genotype confer a risk for breast cancer (52% versus 45%, p = 0.006; OR = 1.33, 95% CI = 1.08–1.64) (28% versus 22%, p = 0.039; OR = 1.43, 95% CI = 0.90–2.25). However, no statistical significant differences were reported for HLA-G + 3187 A > G and HLA-E variations and breast cancer in a Tunisian population.The found results indicate that HLA-G may play an important role in the breast cancer.