Two alleles for rhesus macaque GPR15 (BOB).

Abstract

945 C HE M OKINE REC EPTO RS are used for fusion by primate immunodeficiency viruses. CXCR4 and CCR5 are the two main coreceptors for HIV: they are used by lymphotropic and macrophage-tro pic strains of viruses, respectively. 1±3 Many other chemokine receptors have been described to be involved in fusion, at least in vitro . One of these, GPR15 (also known as BOB), is particularly efficient for fusion of SIV strains. This chemokine receptor has been cloned for pigtail macaques, African green monkeys, and humans. As the rhesus macaque is also widely used to model HIV infection in humans, we cloned and sequenced GPR15 from rhesus macaques. Peripheral blood mononuclear cells (PBMCs) from two male rhesus macaques (92192 and 92193, Chinese subspecies) were cultured for 15 days in the presence of interleukin 2 (IL-2). mRNA were extracted using the RNazol technique (Bioprobe, Montreuil, France) and retrotranscribed (Life Technologies, Cergy Pontoise, France). GPR15 cDNA was amplified using primers we defined from the human sequence. The forward primer was CTGCTCTTTGGTGATGGACCC, and the reverse primer was CCCTTTAGAGTGACACAGACC (Genosys, Pampiford, UK). Polymerase chain reaction (PCR) fragments were blunt-end ligated into the PCR-Script plasmid (Stratagene, La Jolla, CA) according to the manufacturer recommendations. DNA sequencing was performed using dye terminator chemistry on a 383A sequencer (ABI/Perkin-Elmer, Foster City, CA) and sequences were aligned with the SeqEd program. We obtained three clones from animal 92192, and two from animal 92193. Four of these clones were identical in sequence (Fig. 1, allele 1). The sequence presents three substitutions with respect to the pigtail macaque sequence (C156T, C261T, and T779C). Only substitution T779C leads to a change in the amino acid sequence (serine instead of phenylalanine). The rhesus sequence corresponds to the human sequence at that position. The sequence presents 23 substitutions with respect to the human sequence (Fig. 1), leading to 10 substitutions in the amino acid sequence. The fifth clone (from animal 92192) presented an additional substitution: a guanine at position 83 instead of an adenine. The substitution leads to a conservative change in the amino acid sequence (HisR Arg) at position 28 (Fig. 1). This single nucleotide difference could be due to an error made by the Taq polymerase during amplification, or to the presence of a second allele for GPR15 in animal 92192. We therefore sequenced directly the PCR products of both animals. The sequence clearly gave both adenine and guanine at position 83 for animal 92193 (Fig. 2). Two alleles are therefore present for GPR15 in this macaque. The sequence of the PCR products from animal 92192 was not interpretable at that position. The likelyhood of a Taq error at the same site is low. Macaque 92192 is therefore probably also heterozygous for GPR15. We show the existence of two alleles for gpr15 in rhesus macaques. The two alleles are well represented in our colony, as two random ly selected animals were heterozygotes. The existence of two or more alleles has been described for other chemokine receptors. 7,8 The consequences of this polymorphism for fusion of SIV with target cells, and for chemotactism, remain to be determined.