Sequences and predicted structures of chimpanzee STRL33 (Bonzo) and gpr15 (BOB).

Abstract

1315 THE SEV EN -TR AN SM EM BRAN E REC EPTO RS STRL33 and gpr15 have been shown to be coreceptors for many SIV isolates.1–5 They can also be used as coreceptors by some HIV isolates.1,4–6 The STRL33 and gpr15 sequences of human,1–4 African green monkey,1 and pigtail macaque1 have been reported, as has the gpr15 sequence of rhesus macaque. 7 Chimpanzees (Pan troglodytes ) are, however, one of the only primates to be infectable with human immunodefici ency virus type 1 (HIV-1). They are by far the main animal model for the study of HIV-1 infection. 8 We therefore cloned and sequenced chimpanzee STRL33 and gpr15. Chimpanzees were housed in the biosafety level 2 facility of the Laboratory for Experimental Medicine and Surgery in Primates (LEMSIP; New York University, Tuxedo, NY) in accordance with institutional guidelines and standard practices for the containment of infectious diseases and the humane care and use of chimpanzee in biomedical research. 9 Total mRNA was extracted from peripheral blood mononuclear cells (PBMCs) of chimpanzee C-562, C-454, and C-460 by the RNazol technique (Bioprobe, Montreuil, France). mRNA was retrotranscribed (Life Technologies, Cergy Pontoise, France) and cDNA was amplified by polymerase chain reaction (PCR), using either AmpliTaq DNA polymerase (Perkin-Elmer, Foster City, CA) or Pfu DNA polymerase (Stratagene, La Jolla, CA) and humanspecific primers (Genosys, Pampisford, UK). For STRL33 the forward primer was ATGGCAGAGCATGATTAC and the reverse primer was GGCTATAACTGGAACATG, and for gpr15 the forward primer was CTGCTCTTTGGTGATGGACCC and the reverse primer was GGTCTGTGTCACTCTAAAGGG. PCR products were cloned by blunt-end ligation into pCRScript plasmid (Stratagene) according to the manufacturer recommendations . DNA sequencing was performed using dye terminator chemistry on a 373A sequencer (ABI/Perkin-Elmer). All sequences were aligned with the SeqEd program (ABI/Perkin-Elm er). We were able to obtain only one clone for STRL33 from chimpanzee C-562. The nucleotide sequence (Fig. 1) of this clone presents two substitutions (position 38, GR A; and position 754, TR C) with respect to the human sequence. Both substitutions lead to conservative amino acid substitutions S13N (uncharged polar side chain) and F252L (hydrophobic side chain). S13N and F252L are localized in the first extracellular domain and sixth transmem brane domain, respectively. As these substitutions are also present in pigtail macaque and African green monkey STRL33 sequences, they are probably not due to errors of the Taq polymerase during amplification. We therefore believe this clone represents the true sequence for chimpanzee STRL33. We obtained 28 clones for grp15 from chimpanzees C-454 and C-460. Three clones from chimpanzee C-454 and two clones from chimpanzee C-460 were sequenced. The chimpanzee nucleotide sequence (Fig. 2) we report is identical for four clones and presents two substitutions (position 834, TR C; and position 1020, T R G) with respect to the human sequence. These substitutions do not lead to modifications of the amino acid sequence. The substitution at position 834 is present in African green monkey, pigtail macaque, as well as rhesus macaque. The substitution at position 1020 is present only in the chimpanzee, not in other primates. Secondary structures of chimpanzee STRL33 and gpr15 were determ ined using the PROSITE database 10 and are represented in Fig. 3. Seven transm embrane helices and the G protein-coupled receptor signature were found, as expected, for both proteins. STRL33 contains one site for N-linked glycosylation in the first extracellular loop as previously shown.6 We also looked for putative phosphorylation sites in intracellular domains of the proteins. STRL33 contains two phosphorylation sites for protein kinase C, one for protein kinase A, and two for casein kinase II. grp15 contains four phosphorylation sites for protein kinase C, one for protein kinase A, one for casein kinase II, and one for tyrosine kinases. Protein kinases C and A are involved in signaling pathw ays downstream G protein-coupled receptors