Transducin-like Enhancer of Split Proteins, the Human Homologs of Drosophila Groucho, Interact with Hepatic Nuclear Factor 3β

Jen-Chywan Wang,Mary Waltner-Law,Kazuya Yamada,Haruhiko Osawa,Stefano Stifani,Daryl K Granner

doi:10.1074/jbc.m910211199

Jen-Chywan Wang, Mary Waltner-Law + Show 4 more

Open Access

https://doi.org/10.1074/jbc.m910211199

Copy DOI

Abstract

Members of the hepatic nuclear factor 3 (HNF3) family, including HNF3alpha, HNF3beta, and HNF3gamma, play important roles in embryonic development, the establishment of tissue-specific gene expression, and the regulation of gene expression in differentiated tissues. We found, using the glutathione S-transferase pull-down method, that the transducin-like Enhancer of split (TLE) proteins, which are the human homologs of Drosophila Groucho, directly associate with HNF3beta. Conserved region II of HNF3beta (amino acids 361-388) is responsible for the interaction with TLE1. A mammalian two-hybrid assay was used to confirm that this interaction occurs in vivo. Overexpression of TLE1 in HepG2 and HeLa cells decreases transactivation mediated through the C-terminal domain of HNF3beta, and Grg5, a naturally occurring dominant negative form of Groucho/TLE, also increases the transcriptional activity of this region of HNF3. These results lead us to suggest that TLE proteins could influence the expression of mammalian genes regulated by HNF3.

Highlights

Members of the hepatic nuclear factor 3 (HNF3) family, including HNF3␣, HNF3␤, and HNF3␥, play important roles in embryonic development, the establishment of tissue-specific gene expression, and the regulation of gene expression in differentiated tissues
A nonspecific 84-kDa protein appears to bind to GST, a band of stronger intensity was bound to GST1⁄7HNF3␤(CRII/CRIII)
These two proteins were identified when the nuclear extracts prepared from [35S]methionine-labeled H4IIE cells were used to perform the GST1⁄7HNF3␤(CRII/CRIII) pull-down experiments. We determined that these GST1⁄7HNF3␤(CRII/CRIII)-interacting proteins were present in HeLa S3 cells, which can be grown in suspension for production of large quantities of nuclear extracts for further protein purification [26, 27] (Fig. 2B)

Summary

EXPERIMENTAL PROCEDURES

Plasmid Construction—Oligonucleotides that were used in this report were synthesized by an Expedite 8909 oligonucleotide synthesizer (Perceptive Biosystems, Framingham, MA). The nucleotide sequences of rat HNF3␤ corresponding to amino acids 361– 458 (CRII/CRIII), 361– 442 (CRII), and 388 – 458 (CRIII) were generated by polymerase chain reaction using the primer pairs H3/N/361 (GCGCGGATCCGTGAGGCCCACCTGAAGCC) and H3/C/458/E (CGGGAATTCTTAGGTCGAGTTCATAATAG), H3/N/361 and H3/C/442/E (CGGGAATTCTTAGTCTGCAGCCAGGGGC), and H3/N/388 (GCGCGGATCCGTCATCATCATCACAGCCACCAC) and H3/C/458/E, respectively These polymerase chain reaction fragments were digested with EcoRI and BamHI and subcloned into the pGEX3X plasmid (Amersham Pharmacia Biotech). The agarose beads bound with various GST1⁄7HNF3␤ fusion proteins were washed with lysis buffer three times and incubated for 1 h at 4 °C with either [35S]methionine-labeled (0.1 mCi/ml) H4IIE whole cell lysate, HeLa cell nuclear extracts, or TLE1 protein that was translated in vitro using the Promega TNT system. The HeLa cell nuclear extract was incubated with agarose beads bound to the C-terminal transactivation domain of HNF3 (GST1⁄7HNF3␤(CRII/CRIII)). Luciferase activity was measured by the dual luciferase kit (Promega)

RESULTS

TLE Regulates the Activity of the Transactivation Domain of

DISCUSSION