Abstract
GABA(B) receptors mediate slow synaptic inhibition in the central nervous system and are important for synaptic plasticity as well as being implicated in disease. Located at pre- and postsynaptic sites, GABA(B) receptors will influence cell excitability, but their effectiveness in doing so will be dependent, in part, on their trafficking to, and stability on, the cell surface membrane. To examine the dynamic behavior of GABA(B) receptors in GIRK cells and neurons, we have devised a method that is based on tagging the receptor with the binding site components for the neurotoxin, alpha-bungarotoxin. By using the alpha-bungarotoxin binding site-tagged GABA(B) R1a subunit (R1a(BBS)), co-expressed with the R2 subunit, we can track receptor mobility using the small reporter, alpha-bungarotoxin-conjugated rhodamine. In this way, the rates of internalization and membrane insertion for these receptors could be measured with fixed and live cells. The results indicate that GABA(B) receptors rapidly turnover in the cell membrane, with the rate of internalization affected by the state of receptor activation. The bungarotoxin-based method of receptor-tagging seems ideally suited to follow the dynamic regulation of other G-protein-coupled receptors.
Highlights
The trafficking and cell surface mobility of ligand-gated GABAA receptors has been studied using reporter tags with electrophysiological [5] or imaging approaches [6, 7]
To address the topic of GABAB receptor trafficking, prior studies have used various techniques to monitor receptor movement, including: receptor biotinylation [8, 9]; antibody labeling of extracellular GABAB receptor epitopes on live cells [9]; as well as fluorescence recovery after photobleaching (FRAP) [10]. These methods have relied on the use of relatively large reporter molecules, such as antibodies. Such studies have revealed some aspects of trafficking behavior for GABAB receptors, there is still uncertainty regarding: how stable GABAB receptors are in the surface membrane; over what time scale they are likely to traffic; and whether trafficking observed in secondary cell lines is relevant to the movements of GABAB receptors in neurons
Ments in accord with these newly inserted receptors being subject to internalization (Fig. 3C). These results indicate that there are GABAB receptors, forming part of an intracellular pool, which are ready for rapid insertion, and these receptors are subject to internalization as part of a dynamic cycling/rapid turnover of receptors at the cell surface of GIRK cells
Summary
GABAB Receptor Containing the BTX-binding Site—Complementary DNA fragments for the 13 amino acid BBS (WRYYESSLEPYPD;(19)) were synthesized with the nucleotide sequences: CTAGCTGGAGATACTACGAGAGCTCCCTGGAGCCCTACCCTGACG (sense) and CTAGCGTCAGGGTAGGGCTCCAGGGAGCTCTCGTAGTATCTCCAG To image live transfected neurons, PBS with 1 mM d-tubocurarine (d-TC) was applied for 2 min to block endogenous nicotinic ACh ␣7 subunit-containing receptors, and with d-TC (1 mM) ϩ BTX-Rhd (3 g/ml) for 5 min to allow BTXRhd to bind to R1aBBSR2 receptors. The activation of Kir 3.1 and 3.2 channels by GABA was used to construct concentration response curves for wild-type (R1aR2) and mutant R1aBBSR2 GABAB receptors in the presence and absence of 3 g/ml BTX-Rhd (Fig. 1C). There was no significant shift in the concentration response curves, or the potency of GABA, determined from the EC50 values for the R1aBBSR2 receptor in the presence (0.48 Ϯ 0.06 M) or absence (0.36 Ϯ 0.05 M) of BTX-Rhd, y ϭ. Antagonism by the competitive GABAB antagonist CGP55845 at R1aBBSR2 was minimally affected by the BBS (Fig. 1D) with only a small increase in the IC50 at R1aBBSR2 (118 Ϯ 14 nM) compared with wild type (50 Ϯ 6 nM)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
