Abstract
Vesicular stomatitis virus(VSV) is an archetypal member ofMononegavirales which causes important diseases in cattle, horses and pigs. The matrix protein (M) of VSV plays critical roles in the replication, assembly/budding and pathogenesis of VSV. To further investigate the role of M during viral growth, we used a two-hybrid system to screen for host factors that interact with theMprotein. Here, NADH: ubiquinone oxidoreductase complex assembly factor 4 (Ndufaf4) was identified as an M-binding partner, and this interaction was confirmed by yeast cotransformation and GST pulldown assays. The globular domain of M was mapped and shown to be critical for the M-Ndufaf4 interaction. Two double mutations (E156A/H157A, D180A/E181A) in M impaired the M-Ndufaf4 interaction. Overexpression of Ndufaf4 inhibited VSV propagation, and knockdown of Ndufaf4 by short hairpin RNA (shRNA) markedly promoted VSV replication. Finally, we also demonstrate that the anti-VSVeffect of Ndufaf4 is independent of activation of the type I IFN response. These results indicated that Ndufaf4 might exploit other mechanisms to affect VSV replication. In summary, we identify Ndufaf4 as a potential target for the inhibition of VSV propagation. These results provided further insight into the study of VSV pathogenesis.
Highlights
Vesicular stomatitis virus (VSV) is an archetypal member of Mononegavirales which causes important diseases in cattle, horses and pigs
These results provided further insight into the study of VSVpathogenesis
VSV is the pathogen of vesicular stomatitis (VS), an important disease in bovine, horses and swine
Summary
BSR-T7/5 and HEK293T cells were maintained at 37°C in DMEM medium, supplemented with 2 mM Lglutamine and 10% fetal bovine serum (FBS; HyClone).Vesicular stomatitis virus serotype Indiana (VSVIND) was propagated in HEK293T cells. The Ndufaf gene was cloned into the pCMV-flag vector (catalog No 635688; Clontech) to generate the pCMV-flag-Ndufaf plasmid. A eukaryotic Flag-M expression vector designated pT-Flag-M was constructed as previously described[26]. The Ndufaf and M ORFs were cloned at the C-terminus of GST in the pGEX-4T-1 vector to construct prokaryotic expression plasmids. The vector used to deliver short hairpin RNA (shRNA) targeting the Ndufaf gene was constructed using small interfering RNA sequences targeting the Ndufaf gene (1: 5’- GGGAAATCAGCAAGATGAAGCCTCGAGGCTTCATCTTGCTGATTTCCC3’, 2: 5’- GCACTAGTGATTCGCGGTATCCTCGAGGATACCGCGAATCACTAGTGC-3’), and a negative control sequence (NC: 5’-ACGUGACACGUUCGGAGAA-3’) was designed, synthesized and cloned into the pYr-Lvsh lentiviral vector
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have