Abstract
Members of the phosphatidylinositol 3-kinase-related kinase (PIKK) family, including the ATM, DNA-PKcs, Atr, and Trrap proteins, function in signal transduction pathways that activate the DNA damage response. PIKK proteins contain a conserved C-terminal FAT/kinase domain/FATC domain structure. The FATC domain of ATM mediates the interaction between ATM and Tip60, a histone acetyltransferase that regulates activation of ATM. Here, we examined whether the FATC domains of DNA-PKcs, Atr, and Trrap were also able to interact with Tip60. Deletion of the FATC domain of ATM blocked the interaction between ATM and Tip60 and suppressed the activation of ATM kinase activity by DNA damage. Replacement of the FATC domain of ATM with the FATC domains of DNA-PKcs, Atr, or Trrap restored the activation of ATM and its association with Tip60. These results indicate that the FATC domains of DNA-PKcs, Atr, Trrap, and ATM are functionally equivalent. Immunoprecipitation experiments demonstrated that Tip60 is constitutively associated with DNA-PKcs and that the histone acetyltransferase activity associated with DNA-PKcs is up-regulated by DNA damage. When Tip60 expression was suppressed by small interfering RNA, the activation of DNA-PKcs (measured by autophosphorylation of DNA-PKcs at serine 2056 and threonine 2609) was inhibited, demonstrating a key role for Tip60 in the activation of DNA-PKcs by DNA damage. The conserved FATC domain of PIKK proteins may therefore function as a binding domain for the Tip60 histone acetyltransferase. Further, the ability of Tip60 to regulate the activation of both ATM and DNA-PKcs in response to DNA damage demonstrates that Tip60 is a key component of the DNA damage-signaling network.
Highlights
Activate cell cycle checkpoints and regulate DNA repair through phosphorylation of key protein targets
Mutation of these highly conserved residues in the FATC domain of ATM prevents the formation of ATM-Tip60 complexes in vivo [20], implying that the FATC domain may mediate the interaction between ATM and Tip60
The FATC domains of the phosphatidylinositol 3-kinase-related kinase (PIKK) proteins Atr, DNA-PKcs, and Trrap are functionally equivalent when inserted into the ATM protein
Summary
Cells and Antibodies—Culture conditions for 293T, HeLa, and GM5849 AT cells and generation and selection of transfected cell lines is described in Ref. 21. siRNAs T3 (GGAAGCUGCUGAUCGAGUUUU), JUNE 9, 2006 • VOLUME 281 • NUMBER 23 This is an Open Access article under the CC BY license.
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.