Abstract
The endogenous opioid system is evolutionarily conserved across reptiles, birds and mammals and is known to modulate varied brain functions such as learning, memory, cognition and reward. To date, most of the behavioral and anatomical studies in songbirds have mainly focused on μ-opioid receptors (ORs). Expression patterns of δ-ORs in zebra finches, a well-studied species of songbird have not yet been reported, possibly due to the high sequence similarity amongst different opioid receptors. In the present study, a specific riboprobe against the δ-OR mRNA was used to perform fluorescence in situ hybridization (FISH) on sections from the male zebra finch brain. We found that δ-OR mRNA was expressed in different parts of the pallium, basal ganglia, cerebellum and the hippocampus. Amongst the song control and auditory nuclei, HVC (abbreviation used as a formal name) and NIf (nucleus interfacialis nidopallii) strongly express δ-OR mRNA and stand out from the surrounding nidopallium. Whereas the expression of δ-OR mRNA is moderate in LMAN (lateral magnocellular nucleus of the anterior nidopallium), it is low in the MSt (medial striatum), Area X, DLM (dorsolateral nucleus of the medial thalamus), RA (robust nucleus of the arcopallium) of the song control circuit and Field L, Ov (nucleus ovoidalis) and MLd (nucleus mesencephalicus lateralis, pars dorsalis) of the auditory pathway. Our results suggest that δ-ORs may be involved in modulating singing, song learning as well as spatial learning in zebra finches.
Highlights
The endogenous opioid system consists of the opioid ligands endorphin, enkephalin and dynorphin and the receptors that they preferentially bind to, that is, the μ, δ and κ- subtypes, which are inhibitory in nature and belong to the Gi/Go-coupled superfamily of receptors
The primers used in our study generated a single PCR product of 120 bp (TTCAACCTGGCTC TGGCTGATGCAGTGGCCACCAGCACACTGCCCTTCCAGAGCACCAAGTACCTCATGGAGACC TGGCCCTTTGGGGAGCTGCTCTGCAAGGTTGTGCTCTCTATTGAC) which was specific for the OPRD1 cDNA (XM_012570639.3) predicted sequence in the NCBI database [42]
We found that the different parts of hippocampal complex, that is, the dentate gyrus, hippocampal area 2 (Hi2; shown in S3E Fig), the parahippocampal area (APH) and the dorsolateral corticoid area (CDL; not shown) were positive for δ-opioid receptors (ORs) mRNA, but since the hippocampus was taken as a control for normalization, we did not quantify the level of δ-OR mRNA expression in these regions
Summary
The endogenous opioid system consists of the opioid ligands endorphin, enkephalin and dynorphin and the receptors that they preferentially bind to, that is, the μ, δ and κ- subtypes, which are inhibitory in nature and belong to the Gi/Go-coupled superfamily of receptors. The opioid system is involved in physiological functions but is involved in complex behaviors such as socialization [2, 6,7,8] and the motivation to perform different behaviors [9, 10].
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
