The expression of cannabinoid receptor 1 is significantly increased in atopic patients

Abstract

The human endogenous cannabinoid system (ECS) is a complex signaling network involved in a large number of physiological processes. Recently, 2 articles reported in the Journal of Allergy and Clinical Immunology describe that endocannabinoids and cannabinoid receptor (CB) 1 signaling may play a potent inhibitory role in human mast cell (MC) degranulation and activation in the airway mucosa and skin, suggesting that targeting the ECS in these tissues might well represent a novel strategy for the treatment of allergy.1Sugawara K. Zakany N. Hundt T. Emelianov V. Tsuruta D. Schafer C. et al.Cannabinoid receptor 1 controls human mucosal-type mast cell degranulation and maturation in situ.J Allergy Clin Immunol. 2013; 132: 182-193.e8Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 2Sugawara K. Biro T. Tsuruta D. Toth B.I. Kromminga A. Zakany N. et al.Endocannabinoids limit excessive mast cell maturation and activation in human skin.J Allergy Clin Immunol. 2012; 129: 726-738.e8Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar In these studies, the pharmacological blockage or gene silencing of CB1 significantly stimulated the degranulation and maturation of MCs from resident progenitors by mechanisms partially depending on the upregulation of stem cell factor production, which was counteracted by the activation of CB1 with specific agonists. Although it is plausible that the ECS may contribute to the regulation of allergic diseases, studies reporting human data are still scarce. Accordingly, we explored the potential effect of the ECS in human allergic diseases by quantifying and comparing the in vivo mRNA expression levels of the main components of the ECS (the receptors CB1 and CB2 and the enzymes fatty acid amide hydrolase [FAAH] and monoacylglycerol lipase [MAGL] that are involved in the hydrolysis and inactivation of endocannabinoids) in tonsils and PBMCs of atopic and healthy subjects.This study has been reviewed and approved by the ethical committee of Satakunta Central Hospital, Pori, Finland, and the ethical committee of the Medical University of Vienna, Vienna, Austria. Detailed methodology is fully described in this article's Methods section in the Online Repository at www.jacionline.org. We initially explored the in vivo mRNA expression levels of main components of the ECS in palatine tonsils directly excised from 35 atopic patients suffering from allergic rhinitis, atopic dermatitis, and/or asthma and 35 nonatopic controls. The main reason for tonsillectomy was tonsillar hypertrophy or recurrent tonsillectomy without significant differences between both groups (nonatopic vs atopic). Tonsils that showed any sign of infection or microabscess were discarded. As shown in Fig 1, A, the mRNA expression levels of CB1 were significantly higher in tonsils (P = .0002) from atopic patients than in tonsils from nonatopic subjects. There was no significant difference in the mRNA expression levels of CB2, FAAH, and MAGL. We extended the analysis by subgrouping atopic patients according to allergic diseases. As shown in Fig 1, B, the mRNA expression levels of CB1 were significantly higher in tonsils from atopic patients with allergic rhinitis than in nonatopic subjects without significant differences in the other compared genes. We also compared tonsils from 10 atopic patients suffering from atopic dermatitis with tonsils from 35 nonatopic subjects, and significant upregulation of the mRNA levels of CB1 was also observed in patients with atopic dermatitis than in nonatopic subjects without changes for the other analyzed genes (Fig 1, C). These data demonstrated that CB1, CB2, FAAH, and MAGL are expressed in human tonsils and that the atopic patients displayed a significant upregulation of CB1 at the mRNA level. To strengthen our findings in a different population of patients and to determine whether changes in the mRNA expression levels of components of the ECS could also be detected in peripheral blood, we investigated patients who showed clinical anaphylaxis to peanut and an age-matched control group with no allergy. We quantified and compared the mRNA expression levels of the same ECS components in PBMCs from 7 food-allergic and 6 healthy individuals. As shown in Fig 1, D, the mRNA levels of CB1 were also significantly higher in peanut-allergic individuals than in healthy controls without significant differences in the expression levels of CB2, FAAH, and MAGL, demonstrating the same pattern that was observed in the tonsils. To analyze specific cell compartments that might account for differences observed in CB1 mRNA expression, we isolated tonsil mononuclear cells (TMCs) and purified tonsil B and T cells, plasmacytoid dendritic cells (pDCs), and myeloid dendritic cells (mDCs) (see Fig E1 in this article's Online Repository at www.jacionline.org). Supporting our data, CB1 mRNA levels were significantly higher in TMCs from atopic donors than in TMCs from nonatopic donors. Although significant differences were demonstrated only in purified T cells from atopic patients, the same tendency was also observed when comparing CB1 mRNA expression levels in purified B cells, pDCs, and mDCs from nonatopic and atopic patients, suggesting that the higher CB1 mRNA levels found in allergic patients might be due to a contribution of all these different cell subsets. To further verify our findings, we demonstrated that tonsil B cells, T cells, and purified pDCs and mDCs from atopic donors highly express CB1 at the protein level by using the recently designed specific chemical probes3Martin-Couce L. Martin-Fontecha M. Palomares O. Mestre L. Cordomi A. Hernangomez M. et al.Chemical probes for the recognition of cannabinoid receptors in native systems.Angew Chem Int Ed Engl. 2012; 51: 6896-6899Crossref PubMed Scopus (31) Google Scholar that allow the detection of this receptor by confocal microscopy (Fig 2). All these data indicate that not only MCs1Sugawara K. Zakany N. Hundt T. Emelianov V. Tsuruta D. Schafer C. et al.Cannabinoid receptor 1 controls human mucosal-type mast cell degranulation and maturation in situ.J Allergy Clin Immunol. 2013; 132: 182-193.e8Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 2Sugawara K. Biro T. Tsuruta D. Toth B.I. Kromminga A. Zakany N. et al.Endocannabinoids limit excessive mast cell maturation and activation in human skin.J Allergy Clin Immunol. 2012; 129: 726-738.e8Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar but also B cells, T cells, pDCs, and mDCs might play important roles in the regulation of allergic diseases through the ECS. Although future investigations are needed, a potential role of signaling through CB1 inhibiting excessive immune responses in atopic patients or a TH2-polarizing effect might be possible. We have recently shown that human tonsils are lymphoid organs in which the generation of T-cell tolerance due to the suppressive function of allergen-specific FOXP3+ regulatory T cells occurs in vivo by mechanisms partially depending on pDCs.4Palomares O. Ruckert B. Jartti T. Kucuksezer U.C. Puhakka T. Gomez E. et al.Induction and maintenance of allergen-specific FOXP3+ Treg cells in human tonsils as potential first-line organs of oral tolerance.J Allergy Clin Immunol. 2012; 129 (520. e1-9): 510-520Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar This allergen-specific T-cell tolerance can be broken by activation of TLR4 or TLR8 and proinflammatory cytokines such as IL-1 and IL-6.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar The data we report herein demonstrate that differences in mRNA expression levels of CB1 between atopic and nonatopic subjects are detected in tonsils, thus supporting our previous findings showing that tonsils represent peripheral immune responses to allergens in atopic and healthy subjects.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar It is important to note here that the tonsil samples used in this study did not show any sign of infection or abscess and they were not subjected to any cell culture procedure before RNA isolation, thus directly mirroring the in vivo situation in the tissue.Fig 2Protein expression of CB1 in tonsil B cells, T cells, and purified pDCs and mDCs from atopic donors. TMCs were stained for CB1 (green), DAPI (blue), and CD20 (red) for B cells or CD3 (red) for T cells. Purified pDCs and mDCs were stained for CD123 (red) and HLA-DR (red), respectively, in combination with CB1 (green) and DAPI (blue). All preparations were analyzed by using confocal microscopy. Data are from 1 of at least 2 different atopic donors with similar results. White bars, 5 μM. DAPI, 4′-6-Diamidino-2-phenylindole, dihydrochloride.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Alterations in the ECS signaling pathways have been also associated with other diseases including cancer or autoimmune disorders.6Pandey R. Mousawy K. Nagarkatti M. Nagarkatti P. Endocannabinoids and immune regulation.Pharmacol Res. 2009; 60: 85-92Crossref PubMed Scopus (150) Google Scholar In the case of allergic diseases, mouse models demonstrated a beneficial effect of the ECS in allergen-induced airway inflammation.7Braun A. Engel T. Aguilar-Pimentel J.A. Zimmer A. Jakob T. Behrendt H. et al.Beneficial effects of cannabinoids (CB) in a murine model of allergen-induced airway inflammation: role of CB1/CB2 receptors.Immunobiology. 2011; 216: 466-476Crossref PubMed Scopus (28) Google Scholar Interestingly, in other studies, CB2 and endocannabinoids participated in the initiation and maintenance of both the acute and the chronic irreversible acanthosis reactions in mice models of allergic dermatitis.8Mimura T. Ueda Y. Watanabe Y. Sugiura T. The cannabinoid receptor-2 is involved in allergic inflammation.Life Sci. 2012; 90: 862-866Crossref PubMed Scopus (9) Google Scholar In addition, the ECS has been shown to play a pivotal role in the placebo analgesia effects because specific antagonists for CB1 block nonopioid placebo analgesic responses without affecting opioid placebo responses.9Benedetti F. Amanzio M. Rosato R. Blanchard C. Nonopioid placebo analgesia is mediated by CB1 cannabinoid receptors.Nat Med. 2011; 17: 1228-1230Crossref PubMed Scopus (205) Google Scholar Whether CB1 might also be involved in the placebo responses observed in allergic patients during different treatments, such as allergen-specific immunotherapy, remain to be investigated.In conclusion, our data demonstrated for the first time that mRNA expression levels of CB1, a main component of the ECS, are upregulated in tonsils and peripheral blood of patients with 3 different types of allergic diseases: allergic rhinitis, atopic dermatitis, and food allergy. We also show that B cells, T cells, pDCs, and mDCs from atopic donors express high protein levels of CB1, indicating that these cell subsets could also contribute to the regulation of the pathogenesis of allergic diseases mediated by the ECS. Further detailed studies are needed to determine whether the ECS might represent a potential therapeutic target. The human endogenous cannabinoid system (ECS) is a complex signaling network involved in a large number of physiological processes. Recently, 2 articles reported in the Journal of Allergy and Clinical Immunology describe that endocannabinoids and cannabinoid receptor (CB) 1 signaling may play a potent inhibitory role in human mast cell (MC) degranulation and activation in the airway mucosa and skin, suggesting that targeting the ECS in these tissues might well represent a novel strategy for the treatment of allergy.1Sugawara K. Zakany N. Hundt T. Emelianov V. Tsuruta D. Schafer C. et al.Cannabinoid receptor 1 controls human mucosal-type mast cell degranulation and maturation in situ.J Allergy Clin Immunol. 2013; 132: 182-193.e8Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 2Sugawara K. Biro T. Tsuruta D. Toth B.I. Kromminga A. Zakany N. et al.Endocannabinoids limit excessive mast cell maturation and activation in human skin.J Allergy Clin Immunol. 2012; 129: 726-738.e8Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar In these studies, the pharmacological blockage or gene silencing of CB1 significantly stimulated the degranulation and maturation of MCs from resident progenitors by mechanisms partially depending on the upregulation of stem cell factor production, which was counteracted by the activation of CB1 with specific agonists. Although it is plausible that the ECS may contribute to the regulation of allergic diseases, studies reporting human data are still scarce. Accordingly, we explored the potential effect of the ECS in human allergic diseases by quantifying and comparing the in vivo mRNA expression levels of the main components of the ECS (the receptors CB1 and CB2 and the enzymes fatty acid amide hydrolase [FAAH] and monoacylglycerol lipase [MAGL] that are involved in the hydrolysis and inactivation of endocannabinoids) in tonsils and PBMCs of atopic and healthy subjects. This study has been reviewed and approved by the ethical committee of Satakunta Central Hospital, Pori, Finland, and the ethical committee of the Medical University of Vienna, Vienna, Austria. Detailed methodology is fully described in this article's Methods section in the Online Repository at www.jacionline.org. We initially explored the in vivo mRNA expression levels of main components of the ECS in palatine tonsils directly excised from 35 atopic patients suffering from allergic rhinitis, atopic dermatitis, and/or asthma and 35 nonatopic controls. The main reason for tonsillectomy was tonsillar hypertrophy or recurrent tonsillectomy without significant differences between both groups (nonatopic vs atopic). Tonsils that showed any sign of infection or microabscess were discarded. As shown in Fig 1, A, the mRNA expression levels of CB1 were significantly higher in tonsils (P = .0002) from atopic patients than in tonsils from nonatopic subjects. There was no significant difference in the mRNA expression levels of CB2, FAAH, and MAGL. We extended the analysis by subgrouping atopic patients according to allergic diseases. As shown in Fig 1, B, the mRNA expression levels of CB1 were significantly higher in tonsils from atopic patients with allergic rhinitis than in nonatopic subjects without significant differences in the other compared genes. We also compared tonsils from 10 atopic patients suffering from atopic dermatitis with tonsils from 35 nonatopic subjects, and significant upregulation of the mRNA levels of CB1 was also observed in patients with atopic dermatitis than in nonatopic subjects without changes for the other analyzed genes (Fig 1, C). These data demonstrated that CB1, CB2, FAAH, and MAGL are expressed in human tonsils and that the atopic patients displayed a significant upregulation of CB1 at the mRNA level. To strengthen our findings in a different population of patients and to determine whether changes in the mRNA expression levels of components of the ECS could also be detected in peripheral blood, we investigated patients who showed clinical anaphylaxis to peanut and an age-matched control group with no allergy. We quantified and compared the mRNA expression levels of the same ECS components in PBMCs from 7 food-allergic and 6 healthy individuals. As shown in Fig 1, D, the mRNA levels of CB1 were also significantly higher in peanut-allergic individuals than in healthy controls without significant differences in the expression levels of CB2, FAAH, and MAGL, demonstrating the same pattern that was observed in the tonsils. To analyze specific cell compartments that might account for differences observed in CB1 mRNA expression, we isolated tonsil mononuclear cells (TMCs) and purified tonsil B and T cells, plasmacytoid dendritic cells (pDCs), and myeloid dendritic cells (mDCs) (see Fig E1 in this article's Online Repository at www.jacionline.org). Supporting our data, CB1 mRNA levels were significantly higher in TMCs from atopic donors than in TMCs from nonatopic donors. Although significant differences were demonstrated only in purified T cells from atopic patients, the same tendency was also observed when comparing CB1 mRNA expression levels in purified B cells, pDCs, and mDCs from nonatopic and atopic patients, suggesting that the higher CB1 mRNA levels found in allergic patients might be due to a contribution of all these different cell subsets. To further verify our findings, we demonstrated that tonsil B cells, T cells, and purified pDCs and mDCs from atopic donors highly express CB1 at the protein level by using the recently designed specific chemical probes3Martin-Couce L. Martin-Fontecha M. Palomares O. Mestre L. Cordomi A. Hernangomez M. et al.Chemical probes for the recognition of cannabinoid receptors in native systems.Angew Chem Int Ed Engl. 2012; 51: 6896-6899Crossref PubMed Scopus (31) Google Scholar that allow the detection of this receptor by confocal microscopy (Fig 2). All these data indicate that not only MCs1Sugawara K. Zakany N. Hundt T. Emelianov V. Tsuruta D. Schafer C. et al.Cannabinoid receptor 1 controls human mucosal-type mast cell degranulation and maturation in situ.J Allergy Clin Immunol. 2013; 132: 182-193.e8Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 2Sugawara K. Biro T. Tsuruta D. Toth B.I. Kromminga A. Zakany N. et al.Endocannabinoids limit excessive mast cell maturation and activation in human skin.J Allergy Clin Immunol. 2012; 129: 726-738.e8Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar but also B cells, T cells, pDCs, and mDCs might play important roles in the regulation of allergic diseases through the ECS. Although future investigations are needed, a potential role of signaling through CB1 inhibiting excessive immune responses in atopic patients or a TH2-polarizing effect might be possible. We have recently shown that human tonsils are lymphoid organs in which the generation of T-cell tolerance due to the suppressive function of allergen-specific FOXP3+ regulatory T cells occurs in vivo by mechanisms partially depending on pDCs.4Palomares O. Ruckert B. Jartti T. Kucuksezer U.C. Puhakka T. Gomez E. et al.Induction and maintenance of allergen-specific FOXP3+ Treg cells in human tonsils as potential first-line organs of oral tolerance.J Allergy Clin Immunol. 2012; 129 (520. e1-9): 510-520Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar This allergen-specific T-cell tolerance can be broken by activation of TLR4 or TLR8 and proinflammatory cytokines such as IL-1 and IL-6.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar The data we report herein demonstrate that differences in mRNA expression levels of CB1 between atopic and nonatopic subjects are detected in tonsils, thus supporting our previous findings showing that tonsils represent peripheral immune responses to allergens in atopic and healthy subjects.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar It is important to note here that the tonsil samples used in this study did not show any sign of infection or abscess and they were not subjected to any cell culture procedure before RNA isolation, thus directly mirroring the in vivo situation in the tissue. Alterations in the ECS signaling pathways have been also associated with other diseases including cancer or autoimmune disorders.6Pandey R. Mousawy K. Nagarkatti M. Nagarkatti P. Endocannabinoids and immune regulation.Pharmacol Res. 2009; 60: 85-92Crossref PubMed Scopus (150) Google Scholar In the case of allergic diseases, mouse models demonstrated a beneficial effect of the ECS in allergen-induced airway inflammation.7Braun A. Engel T. Aguilar-Pimentel J.A. Zimmer A. Jakob T. Behrendt H. et al.Beneficial effects of cannabinoids (CB) in a murine model of allergen-induced airway inflammation: role of CB1/CB2 receptors.Immunobiology. 2011; 216: 466-476Crossref PubMed Scopus (28) Google Scholar Interestingly, in other studies, CB2 and endocannabinoids participated in the initiation and maintenance of both the acute and the chronic irreversible acanthosis reactions in mice models of allergic dermatitis.8Mimura T. Ueda Y. Watanabe Y. Sugiura T. The cannabinoid receptor-2 is involved in allergic inflammation.Life Sci. 2012; 90: 862-866Crossref PubMed Scopus (9) Google Scholar In addition, the ECS has been shown to play a pivotal role in the placebo analgesia effects because specific antagonists for CB1 block nonopioid placebo analgesic responses without affecting opioid placebo responses.9Benedetti F. Amanzio M. Rosato R. Blanchard C. Nonopioid placebo analgesia is mediated by CB1 cannabinoid receptors.Nat Med. 2011; 17: 1228-1230Crossref PubMed Scopus (205) Google Scholar Whether CB1 might also be involved in the placebo responses observed in allergic patients during different treatments, such as allergen-specific immunotherapy, remain to be investigated. In conclusion, our data demonstrated for the first time that mRNA expression levels of CB1, a main component of the ECS, are upregulated in tonsils and peripheral blood of patients with 3 different types of allergic diseases: allergic rhinitis, atopic dermatitis, and food allergy. We also show that B cells, T cells, pDCs, and mDCs from atopic donors express high protein levels of CB1, indicating that these cell subsets could also contribute to the regulation of the pathogenesis of allergic diseases mediated by the ECS. Further detailed studies are needed to determine whether the ECS might represent a potential therapeutic target. MethodsStudy groupsThis study has been reviewed and approved by the ethical committee of Satakunta Central Hospital, Pori, Finland, and the ethical committee of the Medical University of Vienna, Vienna, Austria. Noninflamed tonsil samples from well-characterized nonatopic and atopic patients undergoing tonsillectomy were taken from Satakunta Central Hospital. Allergic rhinitis and atopic dermatitis status of the patients was determined by a physician according to a well-defined clinical history as previously described.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar Peripheral blood was drawn from individuals with confirmed anaphylaxis to peanut but a negative history for atopic dermatitis and nonatopic healthy controls according to proper guidelines for the diagnosis and management of food allergy.E1Boyce J.A. Assa'ad A. Burks A.W. Jones S.M. Sampson H.A. Wood R.A. et al.Guidelines for the diagnosis and management of food allergy in the United States: report of the NIAID-sponsored expert panel.J Allergy Clin Immunol. 2010; 126: S1-S58Abstract Full Text Full Text PDF PubMed Scopus (1147) Google ScholarIsolation of PBMCs and purification of TMCs and tonsil pDCs and mDCsPBMC were isolated by using Ficoll (Biochrom, Berlin, Germany) density gradient centrifugation from heparinized peripheral venous blood and storage in liquid nitrogen. TMCs and tonsil DC subsets (pDCs and mDCs) were purified following exactly the same protocol previously described by Palomares et al.4Palomares O. Ruckert B. Jartti T. Kucuksezer U.C. Puhakka T. Gomez E. et al.Induction and maintenance of allergen-specific FOXP3+ Treg cells in human tonsils as potential first-line organs of oral tolerance.J Allergy Clin Immunol. 2012; 129 (520. e1-9): 510-520Abstract Full Text Full Text PDF PubMed Scopus (134) Google ScholarRNA extraction, cDNA synthesis, and quantitative real-time RT-PCRTo isolate total RNA directly from palatine tonsil, tissues (that had been previously stabilized in RNAlater) were homogenized in grinding tubes containing CK28 ceramic balls (Bertin, Montigny-le-Brettonneux, France) by using a Precellys 24 homogenizer (Bertin) at 6000 rpm × 2 × 50 seconds. Total RNA from tonsils after tissue homogenization and from PBMCs was isolated by using the RNeasy mini kit (Qiagen, Hombrechtikon, Switzerland).Reverse transcription was performed with the Revert Aid M-MuLV Reverse Transcriptase (Fermentas, Nunningen, Switzerland) using random hexamer primers according to the manufacturer's protocol. Gene expression was analyzed by quantitative real-time PCR using iTaq SYBR Green Supermix with ROX (Bio-Rad, Basel, Switzerland) on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Foster City, Calif). The sequences of the primers used for PCR were as follows: Elongation factor 1α (forward, CTGAACCATCCAAT; reverse, GCCGTGTGGCAATCCAAT), CB1 (forward, AAGGTGACATGGCATCCAAAT; reverse, AGGACGAGAGAGACTTGTTGTAA), CB2 (forward, CACTGATCCCCAATGACTAC; reverse, CCACTCCGTAGAGCATAGAT), FAAH (forward, GGCCACACCTTCCTACAGAA; reverse, GTTTTGCGGTACACCTCGAT), and MAGL (forward, CTGAACCATCCAGGCCAAAT; reverse, GCCGTGTGGCAATCCAAT).PCR conditions were 10 minutes at 95°C followed by 40 cycles of 15 seconds at 90°C and 1 minute at 60°C. Arbitrary units show the 2−(ΔCT) values multiplied by 104, where ΔCT corresponds to the difference between the CT value for the gene of interest and the elongation factor 1α.Synthesis of chemical probes for cannabinoid receptors and binding assaysHigh-affinity ligands for cannabinoid receptors HU210 and HU308 were synthesized according to previously described methods.E2Mechoulam R. Lander N. Breuer A. Zahalka J. Synthesis of the individual, pharmacologically distinct, enantiomers of a tetrahydrocannabinol derivative.Tetrahedron Asymmetry. 1990; 1: 315-318Crossref Scopus (97) Google Scholar, E3Hanus L. Breuer A. Tchilibon S. Shiloah S. Goldenberg D. Horowitz M. et al.HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor.Proc Natl Acad Sci U S A. 1999; 96: 14228-14233Crossref PubMed Scopus (479) Google Scholar The biotinylated derivative of HU210 (HU210-biotin) was prepared starting from (−)-[(6aR,10aR)-3-(1,1-dimethylheptyl)-1-hydroxy-6,6-dimethyl-6a,7,10,10a-tetrahydro-6H-benzo[c]chromen-9-yl]methyl pivalateE2Mechoulam R. Lander N. Breuer A. Zahalka J. Synthesis of the individual, pharmacologically distinct, enantiomers of a tetrahydrocannabinol derivative.Tetrahedron Asymmetry. 1990; 1: 315-318Crossref Scopus (97) Google Scholar and commercially available N-(+)-biotinyl-6-aminohexanoic acid (Sigma-Aldrich, Madrid, Spain). The chemical structure was unequivocally assigned by using high-resolution mass spectrometry and nuclear magnetic resonance. Purity was higher than 95% by elemental analysis. CB1 and CB2 receptor binding assays were performed as previously described.3Martin-Couce L. Martin-Fontecha M. Palomares O. Mestre L. Cordomi A. Hernangomez M. et al.Chemical probes for the recognition of cannabinoid receptors in native systems.Angew Chem Int Ed Engl. 2012; 51: 6896-6899Crossref PubMed Scopus (31) Google Scholar Radioligand competition experiments revealed that HU210-biotin displayed a comparable affinity for human CB1 and CB2 receptors as HU210E4Devane W.A. Breuer A. Sheskin T. Järbe T.U. Eisen M.S. Mechoulam R. A novel probe for the cannabinoid receptor.J Med Chem. 1992; 35: 2065-2069Crossref PubMed Scopus (149) Google Scholar, E5Howlett A.C. Barth F. Bonner T.I. Cabral G. Casellas P. Devane W.A. et al.XXVII. Classification of cannabinoid receptors.Pharmacol Rev. 2002; 54: 161-202Crossref PubMed Scopus (2271) Google Scholar—HU210: Ki (CB1) = 0.061 nM, Ki (CB2) = 0.52 nM; HU210-biotin: Ki (CB1) = 1.6 ± 0.5 nM, Ki (CB2) = 0.36 ± 0.02 nM. For the selective labeling of CB1 receptor, cells were incubated with the chemical probe HU210-biotin in the presence of an excess of the high-affinity ligand of the CB2 receptor HU308: Ki (CB1) >10,000 nM, Ki (CB2) = 22.7 nM.E3Hanus L. Breuer A. Tchilibon S. Shiloah S. Goldenberg D. Horowitz M. et al.HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor.Proc Natl Acad Sci U S A. 1999; 96: 14228-14233Crossref PubMed Scopus (479) Google ScholarVisualization of cannabinoid receptors at the protein level by confocal microscopy Study groupsThis study has been reviewed and approved by the ethical committee of Satakunta Central Hospital, Pori, Finland, and the ethical committee of the Medical University of Vienna, Vienna, Austria. Noninflamed tonsil samples from well-characterized nonatopic and atopic patients undergoing tonsillectomy were taken from Satakunta Central Hospital. Allergic rhinitis and atopic dermatitis status of the patients was determined by a physician according to a well-defined clinical history as previously described.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar Peripheral blood was drawn from individuals with confirmed anaphylaxis to peanut but a negative history for atopic dermatitis and nonatopic healthy controls according to proper guidelines for the diagnosis and management of food allergy.E1Boyce J.A. Assa'ad A. Burks A.W. Jones S.M. Sampson H.A. Wood R.A. et al.Guidelines for the diagnosis and management of food allergy in the United States: report of the NIAID-sponsored expert panel.J Allergy Clin Immunol. 2010; 126: S1-S58Abstract Full Text Full Text PDF PubMed Scopus (1147) Google Scholar This study has been reviewed and approved by the ethical committee of Satakunta Central Hospital, Pori, Finland, and the ethical committee of the Medical University of Vienna, Vienna, Austria. Noninflamed tonsil samples from well-characterized nonatopic and atopic patients undergoing tonsillectomy were taken from Satakunta Central Hospital. Allergic rhinitis and atopic dermatitis status of the patients was determined by a physician according to a well-defined clinical history as previously described.5Kucuksezer U.C. Palomares O. Ruckert B. Jartti T. Puhakka T. Nandy A. et al.Triggering of specific Toll-like receptors and proinflammatory cytokines breaks allergen-specific T-cell tolerance in human tonsils and peripheral blood.J Allergy Clin Immunol. 2013; 131: 875-885Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar Peripheral blood was drawn from individuals with confirmed anaphylaxis to peanut but a negative history for atopic dermatitis and nonatopic healthy controls according to proper guidelines for the diagnosis and management of food allergy.E1Boyce J.A. Assa'ad A. Burks A.W. Jones S.M. Sampson H.A. Wood R.A. et al.Guidelines for the diagnosis and management of food allergy in the United States: report of the NIAID-sponsored expert panel.J Allergy Clin Immunol. 2010; 126: S1-S58Abstract Full Text Full Text PDF PubMed Scopus (1147) Google Scholar Isolation of PBMCs and purification of TMCs and tonsil pDCs and mDCsPBMC were isolated by using Ficoll (Biochrom, Berlin, Germany) density gradient centrifugation from heparinized peripheral venous blood and storage in liquid nitrogen. TMCs and tonsil DC subsets (pDCs and mDCs) were purified following exactly the same protocol previously described by Palomares et al.4Palomares O. Ruckert B. Jartti T. Kucuksezer U.C. Puhakka T. Gomez E. et al.Induction and maintenance of allergen-specific FOXP3+ Treg cells in human tonsils as potential first-line organs of oral tolerance.J Allergy Clin Immunol. 2012; 129 (520. e1-9): 510-520Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar PBMC were isolated by using Ficoll (Biochrom, Berlin, Germany) density gradient centrifugation from heparinized peripheral venous blood and storage in liquid nitrogen. TMCs and tonsil DC subsets (pDCs and mDCs) were purified following exactly the same protocol previously described by Palomares et al.4Palomares O. Ruckert B. Jartti T. Kucuksezer U.C. Puhakka T. Gomez E. et al.Induction and maintenance of allergen-specific FOXP3+ Treg cells in human tonsils as potential first-line organs of oral tolerance.J Allergy Clin Immunol. 2012; 129 (520. e1-9): 510-520Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar RNA extraction, cDNA synthesis, and quantitative real-time RT-PCRTo isolate total RNA directly from palatine tonsil, tissues (that had been previously stabilized in RNAlater) were homogenized in grinding tubes containing CK28 ceramic balls (Bertin, Montigny-le-Brettonneux, France) by using a Precellys 24 homogenizer (Bertin) at 6000 rpm × 2 × 50 seconds. Total RNA from tonsils after tissue homogenization and from PBMCs was isolated by using the RNeasy mini kit (Qiagen, Hombrechtikon, Switzerland).Reverse transcription was performed with the Revert Aid M-MuLV Reverse Transcriptase (Fermentas, Nunningen, Switzerland) using random hexamer primers according to the manufacturer's protocol. Gene expression was analyzed by quantitative real-time PCR using iTaq SYBR Green Supermix with ROX (Bio-Rad, Basel, Switzerland) on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Foster City, Calif). The sequences of the primers used for PCR were as follows: Elongation factor 1α (forward, CTGAACCATCCAAT; reverse, GCCGTGTGGCAATCCAAT), CB1 (forward, AAGGTGACATGGCATCCAAAT; reverse, AGGACGAGAGAGACTTGTTGTAA), CB2 (forward, CACTGATCCCCAATGACTAC; reverse, CCACTCCGTAGAGCATAGAT), FAAH (forward, GGCCACACCTTCCTACAGAA; reverse, GTTTTGCGGTACACCTCGAT), and MAGL (forward, CTGAACCATCCAGGCCAAAT; reverse, GCCGTGTGGCAATCCAAT).PCR conditions were 10 minutes at 95°C followed by 40 cycles of 15 seconds at 90°C and 1 minute at 60°C. Arbitrary units show the 2−(ΔCT) values multiplied by 104, where ΔCT corresponds to the difference between the CT value for the gene of interest and the elongation factor 1α. To isolate total RNA directly from palatine tonsil, tissues (that had been previously stabilized in RNAlater) were homogenized in grinding tubes containing CK28 ceramic balls (Bertin, Montigny-le-Brettonneux, France) by using a Precellys 24 homogenizer (Bertin) at 6000 rpm × 2 × 50 seconds. Total RNA from tonsils after tissue homogenization and from PBMCs was isolated by using the RNeasy mini kit (Qiagen, Hombrechtikon, Switzerland). Reverse transcription was performed with the Revert Aid M-MuLV Reverse Transcriptase (Fermentas, Nunningen, Switzerland) using random hexamer primers according to the manufacturer's protocol. Gene expression was analyzed by quantitative real-time PCR using iTaq SYBR Green Supermix with ROX (Bio-Rad, Basel, Switzerland) on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Foster City, Calif). The sequences of the primers used for PCR were as follows: Elongation factor 1α (forward, CTGAACCATCCAAT; reverse, GCCGTGTGGCAATCCAAT), CB1 (forward, AAGGTGACATGGCATCCAAAT; reverse, AGGACGAGAGAGACTTGTTGTAA), CB2 (forward, CACTGATCCCCAATGACTAC; reverse, CCACTCCGTAGAGCATAGAT), FAAH (forward, GGCCACACCTTCCTACAGAA; reverse, GTTTTGCGGTACACCTCGAT), and MAGL (forward, CTGAACCATCCAGGCCAAAT; reverse, GCCGTGTGGCAATCCAAT). PCR conditions were 10 minutes at 95°C followed by 40 cycles of 15 seconds at 90°C and 1 minute at 60°C. Arbitrary units show the 2−(ΔCT) values multiplied by 104, where ΔCT corresponds to the difference between the CT value for the gene of interest and the elongation factor 1α. Synthesis of chemical probes for cannabinoid receptors and binding assaysHigh-affinity ligands for cannabinoid receptors HU210 and HU308 were synthesized according to previously described methods.E2Mechoulam R. Lander N. Breuer A. Zahalka J. Synthesis of the individual, pharmacologically distinct, enantiomers of a tetrahydrocannabinol derivative.Tetrahedron Asymmetry. 1990; 1: 315-318Crossref Scopus (97) Google Scholar, E3Hanus L. Breuer A. Tchilibon S. Shiloah S. Goldenberg D. Horowitz M. et al.HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor.Proc Natl Acad Sci U S A. 1999; 96: 14228-14233Crossref PubMed Scopus (479) Google Scholar The biotinylated derivative of HU210 (HU210-biotin) was prepared starting from (−)-[(6aR,10aR)-3-(1,1-dimethylheptyl)-1-hydroxy-6,6-dimethyl-6a,7,10,10a-tetrahydro-6H-benzo[c]chromen-9-yl]methyl pivalateE2Mechoulam R. Lander N. Breuer A. Zahalka J. Synthesis of the individual, pharmacologically distinct, enantiomers of a tetrahydrocannabinol derivative.Tetrahedron Asymmetry. 1990; 1: 315-318Crossref Scopus (97) Google Scholar and commercially available N-(+)-biotinyl-6-aminohexanoic acid (Sigma-Aldrich, Madrid, Spain). The chemical structure was unequivocally assigned by using high-resolution mass spectrometry and nuclear magnetic resonance. Purity was higher than 95% by elemental analysis. CB1 and CB2 receptor binding assays were performed as previously described.3Martin-Couce L. Martin-Fontecha M. Palomares O. Mestre L. Cordomi A. Hernangomez M. et al.Chemical probes for the recognition of cannabinoid receptors in native systems.Angew Chem Int Ed Engl. 2012; 51: 6896-6899Crossref PubMed Scopus (31) Google Scholar Radioligand competition experiments revealed that HU210-biotin displayed a comparable affinity for human CB1 and CB2 receptors as HU210E4Devane W.A. Breuer A. Sheskin T. Järbe T.U. Eisen M.S. Mechoulam R. A novel probe for the cannabinoid receptor.J Med Chem. 1992; 35: 2065-2069Crossref PubMed Scopus (149) Google Scholar, E5Howlett A.C. Barth F. Bonner T.I. Cabral G. Casellas P. Devane W.A. et al.XXVII. Classification of cannabinoid receptors.Pharmacol Rev. 2002; 54: 161-202Crossref PubMed Scopus (2271) Google Scholar—HU210: Ki (CB1) = 0.061 nM, Ki (CB2) = 0.52 nM; HU210-biotin: Ki (CB1) = 1.6 ± 0.5 nM, Ki (CB2) = 0.36 ± 0.02 nM. For the selective labeling of CB1 receptor, cells were incubated with the chemical probe HU210-biotin in the presence of an excess of the high-affinity ligand of the CB2 receptor HU308: Ki (CB1) >10,000 nM, Ki (CB2) = 22.7 nM.E3Hanus L. Breuer A. Tchilibon S. Shiloah S. Goldenberg D. Horowitz M. et al.HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor.Proc Natl Acad Sci U S A. 1999; 96: 14228-14233Crossref PubMed Scopus (479) Google Scholar High-affinity ligands for cannabinoid receptors HU210 and HU308 were synthesized according to previously described methods.E2Mechoulam R. Lander N. Breuer A. Zahalka J. Synthesis of the individual, pharmacologically distinct, enantiomers of a tetrahydrocannabinol derivative.Tetrahedron Asymmetry. 1990; 1: 315-318Crossref Scopus (97) Google Scholar, E3Hanus L. Breuer A. Tchilibon S. Shiloah S. Goldenberg D. Horowitz M. et al.HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor.Proc Natl Acad Sci U S A. 1999; 96: 14228-14233Crossref PubMed Scopus (479) Google Scholar The biotinylated derivative of HU210 (HU210-biotin) was prepared starting from (−)-[(6aR,10aR)-3-(1,1-dimethylheptyl)-1-hydroxy-6,6-dimethyl-6a,7,10,10a-tetrahydro-6H-benzo[c]chromen-9-yl]methyl pivalateE2Mechoulam R. Lander N. Breuer A. Zahalka J. Synthesis of the individual, pharmacologically distinct, enantiomers of a tetrahydrocannabinol derivative.Tetrahedron Asymmetry. 1990; 1: 315-318Crossref Scopus (97) Google Scholar and commercially available N-(+)-biotinyl-6-aminohexanoic acid (Sigma-Aldrich, Madrid, Spain). The chemical structure was unequivocally assigned by using high-resolution mass spectrometry and nuclear magnetic resonance. Purity was higher than 95% by elemental analysis. CB1 and CB2 receptor binding assays were performed as previously described.3Martin-Couce L. Martin-Fontecha M. Palomares O. Mestre L. Cordomi A. Hernangomez M. et al.Chemical probes for the recognition of cannabinoid receptors in native systems.Angew Chem Int Ed Engl. 2012; 51: 6896-6899Crossref PubMed Scopus (31) Google Scholar Radioligand competition experiments revealed that HU210-biotin displayed a comparable affinity for human CB1 and CB2 receptors as HU210E4Devane W.A. Breuer A. Sheskin T. Järbe T.U. Eisen M.S. Mechoulam R. A novel probe for the cannabinoid receptor.J Med Chem. 1992; 35: 2065-2069Crossref PubMed Scopus (149) Google Scholar, E5Howlett A.C. Barth F. Bonner T.I. Cabral G. Casellas P. Devane W.A. et al.XXVII. Classification of cannabinoid receptors.Pharmacol Rev. 2002; 54: 161-202Crossref PubMed Scopus (2271) Google Scholar—HU210: Ki (CB1) = 0.061 nM, Ki (CB2) = 0.52 nM; HU210-biotin: Ki (CB1) = 1.6 ± 0.5 nM, Ki (CB2) = 0.36 ± 0.02 nM. For the selective labeling of CB1 receptor, cells were incubated with the chemical probe HU210-biotin in the presence of an excess of the high-affinity ligand of the CB2 receptor HU308: Ki (CB1) >10,000 nM, Ki (CB2) = 22.7 nM.E3Hanus L. Breuer A. Tchilibon S. Shiloah S. Goldenberg D. Horowitz M. et al.HU-308: a specific agonist for CB(2), a peripheral cannabinoid receptor.Proc Natl Acad Sci U S A. 1999; 96: 14228-14233Crossref PubMed Scopus (479) Google Scholar Visualization of cannabinoid receptors at the protein level by confocal microscopy