Abstract
The JAK2 tyrosine kinase is known to associate with the receptors for growth hormone (GH) and erythropoietin (EPO) and with the interleukin-6 receptor signal transducing protein, gp130. Here we demonstrate that chimeric cytokine receptors which contain the cytoplasmic domain of the receptors for GH and EPO or for gp130 can form complexes with JAK2 when transiently co-expressed in HeLa cells. Mutational analyses of chimeras for the the GH and EPO receptors and gp130 demonstrated that box 1, a motif critical for cytokine receptor signal transduction, was required for the association of JAK2. Although JAK2 was capable of associating with all three of the chimeras, JAK1 co-precipitated only with the gp130 chimera. Association of JAK1 and JAK2 with cytokine receptor proteins, therefore, requires the highly conserved box 1 domain, but other sequences within the receptor proteins may influence the specificity of JAK binding. Mutational analysis of JAK2 revealed that multiple or complex protein sequences within JAK2 are required for association with cytokine receptors.
Highlights
From the Center for Immunology and the Departments oftFathology, "Medicine, and 1I11Cell Biology, Washington University School of Medicine, St
Replacement of the ligand binding domain of the growth hormone (GH) and EPO receptors with regions of the VSV G protein prevented us from activating the chimeric cytokine receptors with their cognate ligands, we reasoned that the ability of VSV G to form stable trimers via interactions involving its extracellular domain [35] might mimic ligand-induced cytokine receptor dimerization [1]
Seque nces within the receptor proteins, a ppear to determine t he specificity of JAK kinase association, because JAK2 was cap ab le of assoc iating with all three chimeras, whereas JAK1 interacted with only the gp 130 chimera
Summary
DNA Constructs and Mutagenesis--Creation of the cDNAs for the vesicular stomatitis virus glycoprotein (IISV G) cytokine receptor chimeras was accomplished by polymerasechain reaction (PCR) [29]. Creation of the JAKlfyn and JAK2fyn proteins was accomplished by replacing DNA sequences encoding the tyrosine kinase domain of JAKI and JAK2 with DNA sequences encoding a myc epitope-tagged tyrosine kinase domain of p5g1Yn [31] These modified JAK kinases, contained the carboxyl-terminal 257 amino acid residues of the mouse p5g1Yn protein fused to the JH2 domain The J2/Jl chimera was made in a similar fashion by using the following pairs of primers ATAATAACTGGAAACGGTGGGATCCAGTGGCGGCAG, CTGCCGCCACTGGATCCCACCGTTTCCAGTTATTAT which created BamHI restriction sites (underlined) at the 3' end of the 5' 885 bases of JAK2 and at the 5' end of the JAKlfYn cDNA encoding amino acid 296. Proteins were detected using a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (Bio-Rad) and a chemiluminescence detection system (DuPont-NEN)
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call