The association of Alu repeats with the generation of potential AU-rich elements (ARE) at 3' untranslated regions.

Abstract

BackgroundA significant portion (about 8% in the human genome) of mammalian mRNA sequences contains AU (Adenine and Uracil) rich elements or AREs at their 3' untranslated regions (UTR). These mRNA sequences are usually stable. However, an increasing number of observations have been made of unstable species, possibly depending on certain elements such as Alu repeats. ARE motifs are repeats of the tetramer AUUU and a monomer A at the end of the repeats ((AUUU)nA). The importance of AREs in biology is that they make certain mRNA unstable. Proto-oncogene, such as c-fos, c-myc, and c-jun in humans, are associated with AREs. Although it has been known that the increased number of ARE motifs caused the decrease of the half-life of mRNA containing ARE repeats, the exact mechanism is as of yet unknown. We analyzed the occurrences of AREs and Alu and propose a possible mechanism for how human mRNA could acquire and keep AREs at its 3' UTR originating from Alu repeats.ResultsInterspersed in the human genome, Alu repeats occupy 5% of the 3' UTR of mRNA sequences. Alu has poly-adenine (poly-A) regions at its end, which lead to poly-thymine (poly-T) regions at the end of its complementary Alu. It has been found that AREs are present at the poly-T regions. From the 3' UTR of the NCBI's reference mRNA sequence database, we found nearly 40% (38.5%) of ARE (Class I) were associated with Alu sequences (Table 1) within one mismatch allowance in ARE sequences. Other ARE classes had statistically significant associations as well. This is far from a random occurrence given their limited quantity. At each ARE class, random distribution was simulated 1,000 times, and it was shown that there is a special relationship between ARE patterns and the Alu repeats.Table 1Defined ARE classes. (Symbol marks are used in this study instead of full sequences.)SymbolARE sequenceClass I(AUUU)5AAUUUAUUUAUUUAUUUAUUUAClass II(AUUU)4AAUUUAUUUAUUUAUUUAClass IIIU(AUUU)3AUUAUUUAUUUAUUUAUClass IVUU(AUUU)2AUUUUAUUUAUUUAUUClass VU4AUUUAU4UUUUAUUUAUUUUClass VIW3UAUUUAUW3WWWUAUUUAWWWConclusionAREs are mediating sequence elements affecting the stabilization or degradation of mRNA at the 3' untranslated regions. However, AREs' mechanism and origins are unknown. We report that Alu is a source of ARE. We found that half of the longest AREs were derived from the poly-T regions of the complementary Alu.