Structural and Genetic Analyses Reveal a Key Role in Prophage Excision for the TorI Response Regulator Inhibitor

Latifa Elantak,Mireille Ansaldi,Françoise Guerlesquin,Vincent Méjean,Xavier Morelli

doi:10.1074/jbc.m507409200

Abstract

TorI (Tor inhibition protein) has been identified in Escherichia coli as a protein inhibitor acting through protein-protein interaction with the TorR response regulator. This interaction, which does not interfere with TorR DNA binding activity, probably prevents the recruitment of RNA polymerase to the torC promoter. In this study we have solved the solution structure of TorI, which adopts a prokaryotic winged-helix arrangement. Despite no primary sequence similarity, the three-dimensional structure of TorI is highly homologous to the (lambda)Xis, Mu bacteriophage repressor (MuR-DBD), and transposase (MuA-DBD) structures. We propose that the TorI protein is the structural missing link between the (lambda)Xis and MuR proteins. Moreover, in vivo assays demonstrated that TorI plays an essential role in prophage excision. Heteronuclear NMR experiments and site-directed mutagenesis studies have pinpointed out key residues involved in the DNA binding activity of TorI. Our findings suggest that TorI-related proteins identified in various pathogenic bacterial genomes define a new family of atypical excisionases.

Highlights

The TorI protein was first identified as a TorR response regulator inhibitor [7]
We showed that TorI binds to the C-terminal domain of TorR without affecting its DNA binding capacity, and we proposed that TorI prevents the recruitment of RNA polymerase to the torC promoter [7]
Analysis of the DNA sequences surrounding the genes of the TorI homologues revealed that most of these genes are located near a phage integrase encoding gene, in a pathogenic island, or in a characterized prophage region

Summary

MATERIALS AND METHODS

DNA Manipulations—Small-scale plasmid extractions were carried out by using the Miniprep plasmid kit (Promega), and DNA fragments were purified with the Qiagen PCR purification kit (Qiagen Inc.). DNA sequencing was performed on purified plasmids and PCR products at MWG Biotech. The cat gene was PCR-amplified using pKD3 as a template with the following primers: KplE1-Cm1 (5Ј-CAGGCGAATTTCGTTTGCCCAGGCTGTCCAGTTCGGTTCTGTGTAGGCTGGAGCTGCTTC) and KplE1-Cm2 (5Ј-AGCAGGCCGCCGAATGTGACGGCGAGGTGGTTCGTCCCAACATATGAATATCCTCCTTAG), where the underlined sequences are homologous to the DNA sequence within the KplE1 prophage to allow site-specific recombination by the ␭-Red recombination system. PCR reaction was conducted with 200 ng of template plasmid, 200 ␮M concentration of each dNTPs, and 5 units of DNA polymerase, in the presence of 5% Me2SO, and only 10 amplification cycles were performed to avoid nondesired mutation. The resultant plasmids were purified and sequenced (MWG Biotech) to check for the presence of the desired mutations and the absence of additional mutation in the rest of the torI gene and transformed into the test strain LCB970. To check that TorI mutants were produced and stable in strain LCB970, crude extracts of LCB970 overproducing TorI wild type and mutants were

TABLE ONE

RESULTS AND DISCUSSION

Excision activity of TorI and mutants