Abstract
Several bacterial solute transport mechanisms involve members of the periplasmic binding protein (PBP) superfamily that bind and deliver ligand to integral membrane transport proteins in the ATP-binding cassette, tripartite tricarboxylate transporter, or tripartite ATP-independent (TRAP) families. PBPs involved in ATP-binding cassette transport systems have been well characterized, but only a few PBPs involved in TRAP transport have been studied. We have measured the thermal stability, determined the oligomerization state by small angle x-ray scattering, and solved the x-ray crystal structure to 1.9 A resolution of a TRAP-PBP (open reading frame tm0322) from the hyperthermophilic bacterium Thermotoga maritima (TM0322). The overall fold of TM0322 is similar to other TRAP transport related PBPs, although the structural similarity of backbone atoms (2.5-3.1 A root mean square deviation) is unusually low for PBPs within the same group. Individual monomers within the tetrameric asymmetric unit of TM0322 exhibit high root mean square deviation (0.9 A) to each other as a consequence of conformational heterogeneity in their binding pockets. The gel filtration elution profile and the small angle x-ray scattering analysis indicate that TM0322 assembles as dimers in solution that in turn assemble into a dimer of dimers in the crystallographic asymmetric unit. Tetramerization has been previously observed in another TRAP-PBP (the Rhodobacter sphaeroides alpha-keto acid-binding protein) where quaternary structure formation is postulated to be an important requisite for the transmembrane transport process.
Highlights
Bacterial periplasmic binding proteins (PBPs)2 frequently are associated with one of three active transport systems: the ATP
PBPs form a protein superfamily characterized by two ␣/ domains with a ligand-binding site located at the domain interface [13]
The crystal structures of two (the sialic acid-binding protein from Haemophilus influenzae (SaBP) [16] and the ␣-keto acid-binding protein from Rhodobacter sphaeroides (␣KaBP) [17]) tripartite ATP-independent (TRAP)-PBPs revealed they belong to the PBP group II
Summary
Overexpression, and Purification—The tm0322 gene was amplified from T. maritima genomic DNA by sticky end PCR [19] using the following primers: PO4-TATGTCAGCGGTATTTGGCGCGAAGTACACACTGAG, and TCAGCGGTATTTGGCGCGAAGTACACACTGAG for the 5Ј half of the gene; PO4-AATTCTAATGGTGATGGTGATGGTGCCCAGACTCTCCCTTCACTTCCTTGATCAGCTGG, and CTAATGGTGATGGTGATGGTGCCCAGACTCTCCCTTCACTTCCTTGATCAGCTGG for the 3Ј half of the gene. Monomeric (see Fig. 1B, lane 7) and dimeric (see Fig. 1B, lane 14) fractions from the gel filtration column were concentrated to 3.0 and 1.7 mg/ml, respectively, in a 10 mM Tris, 300 mM NaCl, pH 7.8, buffer for SAXS analysis. Ab Initio Model Construction—Three-dimensional shapes of the monomeric and dimeric proteins were constructed from their respective SAXS data using the GASBOR22IQW program (q range input for each analysis was from 0.01 to 0.04 ÅϪ1) [27], by calculating the distribution of linearly connected 1.9 Å spheres (the number of spheres is set to the number of residues in the protein) that best fit the scattering data. Each calculation was repeated five times with different random starting points for the Monte Carlo optimization algorithm; no predefined shape or symmetry constraints were used From these runs, the predicted structure with the lowest deviation of the calculated scattering profile from experimental data was used for interpretation. The atomic coordinates and diffraction data for the selenomethionine TM0322 structure were deposited in the Protein Data Bank with accession code 2HPG
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
