Abstract
Transcriptional repression of the mouse vascular smooth muscle alpha-actin gene in fibroblasts and myoblasts is mediated, in part, by the interaction of two single-stranded DNA binding activities with opposite strands of an essential transcription enhancer factor-1 recognition element (Sun, S., Stoflet, E. S., Cogan, J. G., Strauch, A. R., and Getz, M. J. (1995) Mol. Cell. Biol. 15, 2429-2436). One of these activities, previously designated vascular actin single-stranded DNA-binding factor 2 includes two distinct polypeptides (p44 and p46) which specifically interact with the purine-rich strand of both the enhancer and a related element in a protein coding exon of the gene (Kelm, R. J., Jr., Sun, S., Strauch, A. R., and Getz, M. J. (1996) J. Biol. Chem. 271, 24278-24285). Expression screening of a mouse lung cDNA library with a vascular actin single-stranded DNA-binding factor 2 recognition element has now resulted in the isolation of two distinct cDNA clones that encode p46 and p44. One of these proteins is identical to Puralpha, a retinoblastoma-binding protein previously implicated in both transcriptional activation and DNA replication. The other is a related family member, presumably Purbeta. Comparative band shift and Southwestern blot analyses conducted with cellular p46, p44, and cloned Pur proteins synthesized in vitro and in vivo, establish identity of p46 with Puralpha and p44 with Purbeta. This study implicates Puralpha and/or Purbeta in the control of vascular smooth muscle alpha-actin gene transcription.
Highlights
Transcriptional activation or repression of RNA polymerase II-dependent genes is often mediated by sequence-specific DNA-binding proteins that respond to extracellular signals by interacting with critical cis-acting regulatory elements
Nuclear proteins from AKR-2B fibroblasts were applied to heparin-agarose resin, eluted stepwise with NaCl, and the fractions monitored for VACssBF2 by band shift assay
The varied expression of vascular smooth muscle (VSM) ␣-actin in phenotypically altered smooth muscle cells and stromal fibroblasts associated with such pathological processes as arteriosclerosis (29 –31), vascular and cutaneous wounding [32, 33], and tumor cell invasion [34, 35] suggests that these cell types have evolved transcriptional mechanisms to both activate and repress VSM ␣-actin gene expression in response to external stimuli
Summary
Oligonucleotide Probes—Oligonucleotide CE-PrM4, a multimer of the VACssBF2 exon-binding site [18] (GGGAGTAATGGTTGGAATGGGCCAAAAAGA) was synthesized on a Applied Biosystems model 394 DNA/RNA synthesizer and gel filtered over a NAP-25 column (Pharmacia) in distilled water. Capture of VACssBF2 from AKR-2B Nuclear Extract Using Oligonucleotide-coupled Paramagnetic Particles—DNA affinity particles were prepared by gently mixing a synthetic 3Ј-biotinylated oligonucleotide (250 pmol) of known VACssBF2-binding specificity (PE-F and PUR-F) or a negative control (PE-R) with a 1-ml suspension of streptavidinparamagnetic particles (Promega) in 25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA (TNE) for 30 min at room temperature. Parallel reaction mixtures containing AKR-2B nuclear protein (150 g) and 12.5 pmol equivalents (50 l) of ssDNA-coupled particles in 0.5 ml of 1 ϫ electrophoretic mobility shift assay buffer (10 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.5 mM EDTA, 0.5 mM dithiothreitol, 50 M spermidine, 15 M spermine, 2.5% (v/v) glycerol) containing 0.01% (v/v) Tween 20 were incubated for 30 min at room temperature. Equivalent amounts of cellular protein were evaluated for p46 (Pur␣) and p44 (Pur) ssDNA binding activity by Southwestern blotting and band shift assay
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
