Selection of Anthrax Toxin Protective Antigen Variants That Discriminate between the Cellular Receptors TEM8 and CMG2 and Achieve Targeting of Tumor Cells

Kuang-Hua Chen,Shihui Liu,Laurie A Bankston,Robert C Liddington,Stephen H Leppla

doi:10.1074/jbc.m611142200

Abstract

Anthrax toxin, a three-component protein toxin secreted by Bacillus anthracis, assembles into toxic complexes at the surface of receptor-bearing eukaryotic cells. The protective antigen (PA) protein binds to receptors, either tumor endothelial cell marker 8 (TEM8) or CMG2 (capillary morphogenesis protein 2), and orchestrates the delivery of the lethal and edema factors into the cytosol. TEM8 is reported to be overexpressed during tumor angiogenesis, whereas CMG2 is more widely expressed in normal tissues. To extend prior work on targeting of tumor with modified anthrax toxins, we used phage display to select PA variants that preferentially bind to TEM8 as compared with CMG2. Substitutions were randomly introduced into residues 605-729 of PA, within the C-terminal domain 4 of PA, which is the principal region that contacts receptor. Candidates were characterized in cellular cytotoxicity assays with Chinese hamster ovary (CHO) cells expressing either TEM8 or CMG2. A PA mutant having the substitutions R659S and M662R had enhanced specificity toward TEM8-overexpressing CHO cells. This PA variant also displayed broad and potent tumoricidal activity to various human tumor cells, especially to HeLa and A549/ATCC cells. By contrast, the substitution N657Q significantly reduced toxicity to TEM8 but not CMG2-overexpressing CHO cells. Our results indicate that certain amino acid substitutions within PA domain 4 create anthrax toxins that selectively kill human tumor cells. The PA R659S/M662R protein may be useful as a therapeutic agent for cancer treatment.

Highlights

Bacillus anthracis, a spore-forming infectious bacterium, produces a toxin consisting of the following three proteins: lethal factor (LF),2 edema factor (EF), and protective antigen
To further characterize protective antigen (PA) domain 4 residues involved in receptor binding and to identify PA mutants that discriminate between tumor endothelial marker 8 (TEM8) and CMG2, we used random mutagenesis and phage display
The bacteriophage having mutations at Asp-683 were obtained in lower numbers than the others. This is surprising because the carboxyl group of the side chain of this residue is critical for interaction with the metal ion present in the metal ion-dependent adhesion site (MIDAS) site of the receptor, so the soluble CMG2 extracellular domain added during panning should have enriched for PA variants having Asp-683 mutations, especially because a D683A substitution still allows about 1/10 the normal binding to the 14B7 antibody [22]

Summary

EXPERIMENTAL PROCEDURES

Reagents—FP59 and PA proteins were prepared as described previously [19, 20]. FP59 is a fusion protein containing residues 1–254 of LF and the ADP-ribosylation domain of Pseudomonas exotoxin A [21]. To express individual PA variants of interest, bacteriophage DNA was amplified in PCRs containing the forward primer 5ЈGATACTGAAGGCCTTAAAGAAGTTATA3Ј and reverse primer 5ЈTCCCGTTGGTCGACGTATCCCCATTCTCACTAGGATT3Ј (StuI and SalI sites are underlined). To obtain all 19 amino acid substitutions of Asn-657, pYS54 DNA was amplified in PCRs containing the forward primer 5ЈGATACTGAAGGCCTTAAAGAAGTTATANNNGACAGATATGATATGTTGAATA3Ј that contains a randomized codon (indicated as NNN) at Asn-657 and reverse primer 5ЈATCTTGCCGTAAACTCGAG3Ј (StuI and XhoI sites are underlined). Culture supernatant (25 ␮l) was used directly in cytotoxicity assays to identify mutated PA proteins that preferentially killed CHO cells overexpressing either TEM8 or CMG2. Human umbilical vein endothelial cells (HUVEC) obtained from Clonetics (San Diego, CA) were cultured in M199 medium containing 10% FBS, 33 ␮g/ml endothelial mitogen, 50 ␮g/ml gentamicin, 2 mM glutamine, 9 units/ml heparin, 25 mM HEPES buffer, pH 7.4. The intercept of the resulting line at the point where log((Ti/To) Ϫ 1) ϭ 0 identifies the competitor concentration equal to the apparent Kd value, a measure of the affinity of the competitor for the receptor used by the toxin to produce toxicity

RESULTS

23 Ͼ2250 Ͼ2250 Ͼ2250

DISCUSSION

Leppla