Abstract
Respiratory syncytial virus (RSV) is a primary cause of severe lower respiratory tract infection in children worldwide. RSV infects airway epithelial cells, where it activates inflammatory genes via the NF-kappaB pathway. NF-kappaB is controlled by two pathways, a canonical pathway that releases sequestered RelA complexes from the IkappaBalpha inhibitor, and a second, the noncanonical pathway, that releases RelB from the 100-kDa NF-kappaB2 complex. Recently we found that the retinoic acid-inducible gene I (RIG-I) is a major intracellular RSV sensor upstream of the canonical pathway. In this study, we surprisingly found that RIG-I silencing also inhibited p100 processing to 52-kDa NF-kappaB2 ("p52"), suggesting that RIG-I was functionally upstream of the noncanonical regulatory kinase complex composed of NIK.IKKalpha subunits. Co-immunoprecipitation experiments not only demonstrated that NIK associated with RIG-I and its downstream adaptor, mitochondrial antiviral signaling (MAVS), but also showed the association between IKKalpha and MAVS. To further understand the role of the NIK.IKKalpha pathway, we compared RSV-induced NF-kappaB activation using wild type, Ikkgamma(-/-), Nik(-/-), and Ikkalpha(-/-)-deficient MEF cells. Interestingly, we found that in canonical pathway-defective Ikkgamma(-/-) cells, RSV induced RelA by liberation from p100 complexes. RSV was still able to activate IP10, Rantes, and Grobeta gene expression in Ikkgamma(-/-) cells, and this induction was inhibited by small interfering RNA-mediated RelA knockdown but not RelB silencing. These data suggest that part of the RelA activation in response to RSV infection was induced by a "cross-talk" pathway involving the noncanonical NIK.IKKalpha complex downstream of RIG-I.MAVS. This pathway may be a potential target for RSV treatment.
Highlights
Previous studies have shown that Respiratory syncytial virus (RSV) induces expression of 16 cytokines and chemokines [4], many of which are NF-B dependent [5, 6]
We found that retinoic acid-inducible gene I (RIGI), a DEXD/H box RNA helicase, was the initial intracellular sensor for RSV infection and upstream of the canonical NF-B pathway [16]
retinoic acid-inducible gene I (RIG-I) is a central regulator of dsRNA-induced domain; TNF, tumor necrosis factor; LT, lymphotoxin ; dsRNA, doublestranded RNA; siRNA, small interfering RNA; mouse embryonic fibroblasts (MEFs), mouse embryonic fibroblast; RT, reverse transcriptase; mAb, monoclonal antibody; CHX, cycloheximide; GFP, green fluorescent protein; YFP, yellow fluorescent protein; nuclear extracts (NE), nuclear extract; TNF receptor-associated factors (TRAFs), tumor necrosis factor receptor-associated factor
Summary
CGATCTAGATTAATCGAGGCAGAGCCGGCCGTAGGCCCTCGCCAAGC signaling for most of the single-stranded RNA viruses [17, 18]. In nondenaturing co-immunoprecipitation experiments, we demonstrated that the NIK1⁄7IKK␣ complex induced RelA release from cytoplasmic p100 complexes. Together, these findings indicate RIG-I controls RelA activation by two distinct downstream signaling modules, one mediated by canonical pathway activation and the second involving a novel cross-talk pathway dependent on complex formation with NIK1⁄7IKK␣ whose activation liberates RelA from p100 sequestration. These findings indicate RIG-I controls RelA activation by two distinct downstream signaling modules, one mediated by canonical pathway activation and the second involving a novel cross-talk pathway dependent on complex formation with NIK1⁄7IKK␣ whose activation liberates RelA from p100 sequestration Targeted disruption of this pathway may have significant effects in modulating the inflammatory response to RSV without affecting the viral replication
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
