Year-end Sale % OFF 
Abstract
Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of 20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.
Highlights
Meat and secondary raw materials may be infected with pathogens inducing a group of diseases characterized by progressive destruction of different parts of the nervous system and possessing an unusual genetic mechanism of occurrence and development, i.e. so-called prion diseases
It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle [2]
Based on the studies, high performance DNA target was selected; two primers were designed to meet the requirements for PCR reaction; the optimal denatur
Summary
Meat and secondary raw materials may be infected with pathogens inducing a group of diseases characterized by progressive destruction of different parts of the nervous system and possessing an unusual genetic mechanism of occurrence and development, i.e. so-called prion diseases. In this respect, meat raw materials quality control is a new rapidly developing field of biomedical research, which has acquired great scientific and practical significance in recent years [1]. По этому усовершенствование и разработка чувствительных, специфичных и экспрессных методов идентификации патогенной формы прионного белка являются актуальной проблемой.
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
