Abstract
Observations of Golgi fragmentation upon introduction of G protein βγ (Gβγ) subunits into cells have implicated Gβγ in a pathway controlling the fission at the trans-Golgi network (TGN) of plasma membrane (PM)-destined transport carriers. However, the subcellular location where Gβγ acts to provoke Golgi fragmentation is not known. Additionally, a role for Gβγ in regulating TGN-to-PM transport has not been demonstrated. Here we report that constitutive or inducible targeting of Gβγ to the Golgi, but not other subcellular locations, causes phospholipase C- and protein kinase D-dependent vesiculation of the Golgi in HeLa cells; Golgi-targeted β(1)γ(2) also activates protein kinase D. Moreover, the novel Gβγ inhibitor, gallein, and the Gβγ-sequestering protein, GRK2ct, reveal that Gβγ is required for the constitutive PM transport of two model cargo proteins, VSV-G and ss-HRP. Importantly, Golgi-targeted GRK2ct, but not a PM-targeted GRK2ct, also blocks protein transport to the PM. To further support a role for Golgi-localized Gβγ, endogenous Gβ was detected at the Golgi in HeLa cells. These results are the first to establish a role for Golgi-localized Gβγ in regulating protein transport from the TGN to the cell surface.
Highlights
G protein signaling was thought to occur only at the cytoplasmic surface of the plasma membrane (PM); accumulating evidence indicates a role for G proteins at subcellular locations in addition to the PM
Sequestration of endogenous G␥ using a Golgi-directed GPCR kinase 2 (GRK2) C-terminal domain (GRK2ct) inhibits the transport of PM-destined cargo, and a novel pharmacological inhibitor of G␥, gallein, likewise inhibits transport from the trans-Golgi network (TGN) to PM. These results provide the first demonstration that G␥ is critical for the formation of TGN-to-PM transport carriers and that G␥ is functioning at Golgi membranes to regulate a PKD-dependent signaling pathway there
1␥2 and 5␥2 were transfected into HeLa cells, and the organization of the Golgi apparatus was monitored by immunofluorescence microscopy, using antibodies against TGN46 and GM130 as markers for the trans and cis Golgi network, respectively. 1␥2 caused Golgi breakdown in
Summary
Reagents—The rapamycin analog AP21967 and the Argent Regulated Heterodimerization Kit were generously provided by ARIAD pharmaceuticals (Cambridge, MA). An endoplasmic reticulum (ER)-targeting sequence from pEYFP-IBV-M1, a generous gift from Dr Mark Philips (New York University), was amplified by PCR and inserted at the 5Ј end of wild-type ␥2 to create ER-␥2. PM-GRK2ct was created using the 66-amino acid C-terminal sequence of the Rit GTPase from YFP-Rit-CT, a generous gift from Dr Mark Philips (New York University), flanked by GATAGTGCTGGTAGTGCTGGT as a linker, and fused to the C terminus of GRK2ct. Cells were washed with fresh media and transfected with a plasmid coding for tsO45 VSV-G protein with a GFP tag. For experiments in which cells were treated with the inhibitor gallein, the first transfection step was omitted, and the inhibitor was added after 1.5-h incubation at 20 °C. ss-HRP Secretion Assay—24 h after transfection with the indicated GRK2ct plasmids, HeLa cells were transfected with the ss-HRP plasmid. A background reading, from media of cells transfected with pcDNA3 but without ss-HRP, was subtracted from each sample
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
