Abstract
U8 small nuclear RNA is a new, capped, 140 nucleotides long RNA species found in Novikoff hepatoma cells. Its sequence is: m3GpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCC UCCUUUCGGA GGGCAGAUAG AAAAUGAUGA UUGGAGCUUG CAUGAUCUGC UGAUUAUAGC AUUUCCGUGU AAUCAGGACC UGACAACAUC CUGAUUGCUU CUAUCUGAUUOH. This RNA is present in approximately 25,000 copies/cell, and it is enriched in nucleolar preparations. Like U1, U2, U4/U6, and U5 RNAs, U8 RNA was also present as a ribonucleoprotein associated with the Sm antigen. The rat U8 RNA was highly homologous (greater than 90%) to a recently characterized 5.4 S RNA from mouse cells infected with spleen focus-forming virus (Kato, N., and Harada, F. (1984) Biochim. Biophys. Acta, 782, 127-131). In addition to the U8 RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells. Each of these contained a m3GpppAm cap structure; their apparent chain lengths were 60, 130, and 65 nucleotides. These U small nuclear RNAs are designated U7, U9, and U10 RNAs, respectively.
Highlights
US small nuclear RNA is a new, capped, 140 nucleo- nuclear and nucleolar RNAs were done as described previously [20]
Tides long RNA species found in Novikoff hepatoma Estimation of the copy number of US RNA was obtained from the cellsI.ts sequence ism: sGpppAmUmCGUCAGGA GGUUAAUCCU UACCUGUCCCUCCUUUCGGA
In addition to the US RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells
Summary
Fig. 1shows the fractionation of small RNAs present in the immunoprecipitates obtained using the anti-Sm antibodies (lanes and 3). In addition to the US RNA, three other U small nuclear RNAs were found in anti-Sm antibody immunoprecipitates from labeled rat and HeLa cells Each of these contained a msGpppAm cap structure;their apparent chain lengths were 60, 130, and 6 5 nucleotides. The Novikoff hepatoma cells or HeLa cells were labeled with [“PI following the method of Silberklang et al [26], and the cap phosphate as described by Mauritzen et al [19].The immunoprecip- structures had the same mobility as that of msGpppAm obitations using anti-Sm and other antibodies were performed as described by Lerner and Steitz [2].The U8 RNA used in sequencing studies was isolated by fractionating nuclear 4-8 S RNA on 10% polyacrylamide gels [20].
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
