Abstract
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (100 to 107 bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF–5’gcgctcaggctgccgacgcaa3’ (6-FAM labeled) and BR–5´accagccattgcggtcggta3’ for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 103 bacteria/mL, while for silver stained 8% poliacrylamide gel it was 105 bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.KEYWORDS: bovine semen; Brucella abortus; capillary electrophoresis; diagnostic fluorescent PCR.
Highlights
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen
A contaminação experimental do sêmen foi realizada com concentrações decrescentes de Brucella abortus obtidas por meio de diluições seriadas na base 10 (107 a 100 bactérias/mL), para assim determinar a menor concentração de DNA bacteriano capaz de ser detectada através da técnica de PCR
Ciência Animal Brasileira, v. 9, n. 3, p. 753-758, 2008
Summary
FRANCISCA ELDA FERREIRA DIAS1, CÁRIS MARONE NUNES2, TÂNIA VASCONCELOS CAVALCANTE1, ANDRÉA AZEVEDO PIRES DE CASTRO3, JORGE LUIS FERREIRA1, JOSÉ FERNANDO GARCIA2. Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF–5’gcgctcaggctgccgacgcaa3’ (cromóforo FAM) e BR–5’accagccattgcggtcggta3’ para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 103 bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 105 bactérias/mL. PALAVRAS-CHAVE: Brucella abortus; diagnóstico; eletroforese capilar; PCR fluorescente; sêmen bovino
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.