Abstract
APOBEC-1-catalyzed apolipoprotein B (apoB) mRNA editing requires auxiliary factors, but the number and functions of these factors are unknown. We have partially purified the editing activity from extracts of a McArdle cell line overexpressing His6-hemagglutinin-tagged, rat APOBEC-1 using metal-chelating affinity chromatography. The 1,200-fold purification achieved by this approach was partially dependent on exogenously added RNA containing a mooring sequence for editosome assembly. Affinity-purified editing activity could be separated by 300 mM NaCl extraction into two fractions, a salt-resistant fraction (editing fraction 1; EF1) and a salt-soluble fraction (EF2). Neither EF1 nor EF2 alone could edit apoB RNA, but when added together they reconstituted full editing activity. Previously identified candidate auxiliary factors including the p66/p44 apoB RNA binding proteins and the presumptive editosome assembly factor p240 were all present in the affinity-purified editing complex. Moreover, virtually all of p66, p240, and APOBEC-1 were present in EF1, whereas p44 was quantitatively recovered in EF2. This is the first demonstration that p66 and p44 can bind to apoB RNA independently of one another. In addition, 100- and 55-kDa apoB RNA cross-linking proteins have been identified in the APOBEC-1 affinity-purified material. RNA competition studies demonstrated that p100, p66, and p55 bound selectively to apoB RNA, whereas p44 had general RNA cross-linking characteristics. The data underscore the multiplicity of auxiliary factors potentially involved in apoB RNA editing and suggest an editosome far more complicated than may have been previously appreciated.
Highlights
ApoB1 mRNA undergoes a post-transcriptional editing process involving a site-specific deamination of cytidine at nucleotide 6666, converting a CAA glutamine codon (2156) to a UAA
APOBEC-1—Previous data from our laboratory [27] and that of Driscoll [28] demonstrated that the auxiliary factors required for apolipoprotein B (apoB) RNA editing could be adsorbed from McArdle cell extracts using affinity columns immobilized with E. coli expressed recombinant His6-APOBEC-1
These studies have the potential limitation that E. coli-expressed APOBEC-1 may not contain the appropriate post-translation modifications required for optimal interactions with the auxiliary factors
Summary
Plasmid Construction—apobec-1 cDNA was amplified from pPROEX-apobec-1 [27] by PCR using Pfu DNA polymerase (Stratagene, CA) and primers YY5Ј (GGGGCCGATATCGTGAGTTCCGAGAC) and YY3Ј (GCTCTAGAGCTCATTTCAACCCTGTG) and subcloned in pcDNA3 (Invitrogen, CA) at the EcoRV/XbaI sites. Affinity Chromatography—Two volumes of 15% (NH4)2SO4 fractionated extracts preincubated with either in vitro transcribed apoB or WT-1 RNA (10 fmol/g extract protein) at 30 °C for 30 min were mixed with 1 bed volume of TALONTM (CLONTECH) metal affinity resin (equilibrated with buffer B containing 0.1% Nonidet P-40 (v/v)) and tumbled for 1 h at 4 °C. Salt extracts were obtained by incubating the resin-bound editosomes, prepared as described above, with 1 bed volume of buffer C containing the indicated concentrations of NaCl at room temperature for 15 min. Protein Concentration Determination—Affinity-purified proteins were stripped from TALONTM resin with 3 bed volumes of 500 mM EDTA according to the manufacturer’s protocols (CLONTECH) These proteins and those obtained from NaCl extraction of affinity-purified material were dialyzed against 2 liters of distilled water, quick frozen in dry ice-ethanol bath, and lyophilized to the desired volume. Aliquots were assayed for protein concentration with the Bio-Rad assay system
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
