Abstract
Recently, we cloned and characterized cDNA encoding a novel, protein kinase C (designated PKC1B) from Caenorhabditis elegans. PKC1B (707 amino acid residues) is a developmentally regulated, calcium-independent kinase that is expressed exclusively in sensory neurons and related interneurons. We have now discovered a mechanism by which a second, distinct mRNA (PKC1A mRNA) with increased protein coding potential is generated from the C. elegans PKC1 gene. PKC1A mRNA is produced in a process that involves the utilization of an alternative, distal promoter, the incorporation of two unique exons into the mRNA, and alternative cis/trans splicing. Diversity among PKC1 gene transcripts is increased substantially by trans-splicing. The 5' end of PKC1A mRNA contains an acceptor site that is modified by the addition of either a classical spliced leader sequence 2 or one of four novel spliced leaders. PKC1A mRNA encodes a predicted kinase that contains the entire sequence of PKC1B as well as an N-terminal extension of 56 residues. The extension contains a preponderance of basic amino acids. The levels of transcripts arising from the distal (1A) and proximal (1B) promoters for the PKC1 gene are differentially regulated during C. elegans development. The ratio of 1B mRNA:1A mRNA varies from 40:1 to unity as the nematodes progress from early larval stages to mature adults. The novel exons in the PKC1A structural gene are not contiguous with the PKC1A promoter but are instead positioned downstream from a second gene, kinase upstream gene-1, in the context of a multicystronic operon. PKC1A and kinase upstream gene-1 mRNAs are coordinately expressed in a fixed ratio throughout C. elegans post-embryonic development, suggesting that a shared upstream promoter regulates transcription of both genes. Finally, PKC1A and PKC1B mRNA levels are differentially regulated by phorbol esters in a process that may involve the participation of another PKC isoform that is analogous to mammalian PKC delta.
Highlights
PKClAand PKClB mRNA levels are differentially regulated by phorbol esters in a process that may involve the participation of another protein kinase C (PKC) isoform that is analogous to mammalian PKCG
We further demonstrated that the PKCplrBotein and transcriptional activity of the PKClB promoter are expressed exclusively in -75 sensory neurons and related inreverse transcription and polymerase chain reaction (PCR) amplification were identical with those described in detail in Land et al [37]. cDNA obtained from the second round of amplification was purifiedon a 1.5% lowmelting point agarose gel, as described earlier A(4p9p)r.oximately 10% of this product was amplified using the conditions of terneurons
The relative (Fig. 1B)in exon I of the PKCl gene corresponds to a variant abundance of PKClB mRNA was normalized to PKClmBRNA content but functional poly(A)addition signal.This suggested that exon I is located immediately downstream from another structural in L4 nematodes.Ratios of theabsolutevalues PKClA mRNA are presented inTable I
Summary
Properties of the Growth of C. elegans-The Bristol N2 strain of C. elegans was grown, probes and the anticipated, protected fragments are described under synchronized, and harvested as describedaipnrevious publication [41]. Fragelegans, and egg-laying adult nematodes were isolated are given in ments of 32P-labeled probe protected by PKClA and PKClB mRNAs. Land et al [37]. The tpa-l gene quantified using a Molecular Dynamics PhosphorImager as previously encodes a PKC that is homologous with mammalian PKCG. The integrity of the total RNA preparations was verified by hybridmRNA were obtainedfrom recombinant AZAP and hgtllbacteriophage izingNorthernblotswitha32P-labeled DNA probe that contains a libraries as previously described [37]. B containing mM NaCl, 0.2M NaC1,0.4 M NaCl, or1M NaCl. Proteins tttatgatCttatatttttcacaaaatactcacaaa=t=taaaatgttat in the various fractions were subjected to Western immunoblot analysis -413 aaa=taattttcagggtcgaggagccgtgaaatgcggatttcttttcggc as previously described [37]. -113 aatttatttgtttcEatgttttgttatgtattttatttt~tatgaagctg cedure [37]
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.