Occurrence of Hop Latent Viroid Causing Disease in Cannabis sativa in California

Abstract

In 2017 disease symptoms were noticed on multiple cultivars of Cannabis sativa plants grown in California, including stunting, malformation or chlorosis of leaves, brittle stems, and reduction in yields. Additionally, cuttings taken from symptomatic plants for clonal propagation showed a reduced rooting success rate. Leaf tissues from five symptomatic and five asymptomatic plants were selected for RNA isolation and subsequent sequencing from northern California (37.7567466, –122.1930517). Total RNA was isolated from leaf tissue using TRIzol reagent (Thermo Fisher). Ribosomal RNA was removed using a Ribo-Zero rRNA Removal Kit, Plant (Illumina). RNA-seq libraries were synthesized using YourSeq RNA-seq kit for full transcript coverage libraries (Amaryllis Nucleics, Oakland, CA). Libraries were sequenced on an Illumina NextSeq 500 using single-read 80 bp (Amaryllis Nucleics). Each sample resulted in between 12,861,714 and 19,376,549 reads (data available at www.mg-rast.org, project HpLVd - Can). The resulting sequences were de novo assembled, and the resulting contigs were aligned to the Cannabis sativa draft genome (ASM341772v2). Contigs that matched the Cannabis sativa genome were removed from the analysis, and the remaining contigs were compared with sequences in the viral and viroid GenBank databases. All five symptomatic plants had a single 256-nucleotide contig (total reads mapped per contig ranged from 4,162 to 50,095) that matched hop latent viroid (HLVd). HLVd is a 256-nucleotide circular RNA belonging to the Cocadviroid family first described by Puchta et al. (1988). These results suggested that HLVd was associated with the disease symptoms. To confirm the presence of HLVd in symptomatic plants, RNA was extracted from the original five symptomatic and five asymptomatic plants, and HLVd-specific reverse transcription PCR (RT-PCR) was performed using the outward primers HLVdF (5′‐201ATACAACTCTTGAGCGCCGA220‐3′) and HLVdR (5′-200CCACCGGGTAGTTTCCAACT181‐3′) (Matousek and Patzak 2000). All five symptomatic plants tested positive for the presence of HLVd, and all the asymptomatic plants were negative for the viroid. Sanger sequencing of two positive samples using the products of these primers cloned into pCRBlunt II-TOPO vector (Thermo Fisher) confirmed the presence of two distinct isolates: Can1 (MK876285) was a 100% sequence match to the published HLVd genome (NC_003611.1, Germany), and Can2 (MK876286) matched isolate H2 (EF613183), which has a single nucleotide change U225A. To demonstrate causation for this disease, an infectious HLVd clone construct was created as described by Feldstein et al. (1998). Infectious RNA was produced from the construct using T7 RNA polymerase (Thermo Fisher), resulting in two discrete infectious RNAs, which were gel purified individually and rub inoculated onto RT-PCR confirmed healthy plants with carborundum and 20 mM sodium phosphate buffer (pH 7.0). In total, four healthy plants were inoculated with carborundum and phosphate-buffered saline (mock inoculated control), and four healthy plants for each were inoculated with infectious RNA 1 or infectious RNA 2 using the same method as the mock control. The plants were grown in an indoor nursery and monitored over 3 months. Only the plants that were inoculated with the infectious RNA constructs showed stunting, malformed and chlorotic leaf symptoms, and tested positive for the presence of HLVd by RT-PCR. These results confirm the occurrence of HLVd in Cannabis sativa.