Abstract
Expression of the cytokine interleukin-13 (IL13) is critical for Th2 immune responses and Th2-mediated allergic diseases. Activation of human IL13 expression involves chromatin remodeling and formation of multiple DNase I-hypersensitive sites throughout the locus. Among these, HS4 is detected in the distal IL13 promoter in both naive and polarized CD4(+) T cells. We show herein that HS4 acts as a position-independent, orientation-dependent positive regulator of IL13 proximal promoter activity in transiently transfected, activated human CD4(+) Jurkat T cells and primary murine Th2 cells. The 3'-half of HS4 (HS4-3') was responsible for IL13 up-regulation and bound nuclear factor (NF) 90 and NF45, as demonstrated by DNA affinity chromatography coupled with tandem mass spectrometry, chromatin immunoprecipitation, and gel shift analysis. Notably, the CTGTT NF45/NF90-binding motif within HS4-3' was critical for HS4-dependent up-regulation of IL13 expression. Moreover, transfection of HS4-IL13 reporter vectors into primary, in vitro differentiated Th2 cells from wild-type, NF45(+/-), or NF90(+/-) mice showed that HS4 activity was exquisitely dependent on the levels of endogenous NF45 (and to a lesser degree NF90), because HS4-dependent IL13 expression was virtually abrogated in NF45(+/-) cells and reduced in NF90(+/-) cells. Collectively, our results identify NF45 and NF90 as novel regulators of HS4-dependent human IL13 transcription in response to T cell activation.
Highlights
We recently characterized the dynamic modifications in DNase I hypersensitivity and epigenetic marks that occur at the human IL13 locus during the differentiation of naive CD4ϩ Th cells into a polarized IL-13/IL-4 secreting Th2 phenotype [17]
We show that HS4 does act as a novel positive regulator of human IL13 promoter activity in response to T cell activation
These results demonstrate that HS4-dependent IL13 enhancement is exquisitely dependent on the endogenous levels of NF45, and to a lesser extent of NF90, suggesting that NF45 and NF90 act as positive regulators of IL13 expression and confirming the important role these factors play in HS4-mediated IL13 regulation
Summary
Mice—C57BL/6 wild-type (WT) mice obtained from The Jackson Laboratory and NF45ϩ/Ϫ 3 and NF90ϩ/Ϫ [20] mice on a C57BL/6 background were maintained under specific pathogen-free conditions. The Ϫ1650IL13p/Luc, Ϫ1577IL13p/Luc, and Ϫ1446IL13p/Luc constructs were generated by PCR amplification using distinct forward primers (5ЈATACTCGGTACCATAAGGGGCGTTGACTCAC, 5ЈATACTCGGTACCATCACGGAGACCCTGTGGGAGAT, and 5ЈATACTCGGTACCTGGGAGTCAGAGCCAGCGCT) and a single reverse primer (5ЈTTGATGCTAGCCAGTGCCAACAGGAGAGGATT) Each of these regions was cloned into the KpnI and NheI restriction sites of pGL3 Basic. The column was removed from the magnet and bead-DNA-protein complexes were eluted with wash buffer supplemented with 8.5 mM MgCl2 and 1 mM DTT. Nuclear extracts (15 g) were incubated with 32P-labeled oligonucleotide probes in binding buffer (100 mM Tris-Cl, 10 mM EDTA, 10 mM DTT, 5 mM MgCl2, 8 mM Na2HPO4, pH 7.5, 0.6 mM NaN3, 400 ng/l bovine serum albumin, 160 mM NaCl, 30% glycerol) and poly(dI-dC) (50 ng/l) for 30 min at 4 °C.
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call