Multiple Regions of MAP Kinase Phosphatase 3 Are Involved in Its Recognition and Activation by ERK2

Bo Zhou,Li Wu,Kui Shen,Jialin Zhang,David S Lawrence,Zhong-Yin Zhang

doi:10.1074/jbc.m009753200

Abstract

Mitogen-activated protein kinase phosphatase 3 (MKP3) is a specific regulator of extracellular signal-regulated protein kinase 2 (ERK2). Association of ERK2 with MKP3 results in a powerful increase in MKP3 phosphatase activity. To determine the molecular basis of the specific ERK2 recognition by MKP3 and the ERK2-induced MKP3 activation, we have carried out a systematic mutational and deletion analysis of MKP3. Using activation-based and competition-based assays, we are able to quantitatively evaluate the contributions that residues/regions within MKP3 make to ERK2 binding and ERK2-induced MKP3 activation. Our results show that recognition and activation of MKP3 by ERK2 involves multiple regions of MKP3. Thus, the kinase interaction motif (KIM; residues 61--75) in MKP3 plays a major role (135-fold) for high affinity ERK2 binding. The most important residue in the KIM sequence of MKP3 is Arg(65), which probably interacts with Asp(319) in ERK2. In addition to KIM, a unique sequence conserved in cytosolic MKPs (residues 161--177 in MKP3) also contributes to ERK2 binding (15-fold). However, these two regions are not essential for ERK2-induced MKP3 activation. A third ERK2 binding site is localized in the C terminus of MKP3 (residues 348--381). Although deletion of this region or mutation of the putative ERK specific docking sequence (364)FTAP(367) in this region reduces MKP3's affinity for ERK2 by less than 10-fold, this region is absolutely required for ERK2-induced MKP3 activation.

Highlights

Our results show that the recognition of and activation by ERK2 involves multiple regions of MKP3
We have shown that the KIM sequence in MKP3 is important for high affinity ERK2 binding
We have identified a unique sequence conserved in cytosolic MKPs that contributes to ERK2 binding (15-fold)

Summary

EXPERIMENTAL PROCEDURES

DNA Construction of MKP3 and Its Mutants—The coding sequence for the wild type MKP3 with a C-terminal His tag was produced by PCR using the oligonucleotides GGCCATATGATAGATACGCTCAGACCCG (NdeI site underlined) and GCCGAATTCTCAGGTGGTGGTGGTGGTGCGTAGATTGCAGGGAGTC (EcoRI site and His tag underlined) as the 5Ј and 3Ј primers, respectively, using pGEX-4T3-MKP3 (a generous gift from Dr Marco Muda, University of Michigan) as a template. Steady-state Kinetics—The phosphatase activity of MKP3 or its mutants was assayed using pNPP as a substrate at 30 °C in 50 mM 3,3-dimethylglutarate buffer, pH 7.0, containing 1 mM EDTA with an ionic strength of 0.15 M adjusted by the addition of NaCl. The reaction was initiated by the addition of the enzyme to a reaction mixture (0.2 ml) containing various concentrations of pNPP and quenched after 60 min by the addition of 0.05 ml of 5 N NaOH. For peptides corresponding to the kinase interaction motif (KIM) and the N-terminal fragments of MKP3, which lack phosphatase activity, the competitive binding assay was used to determine the binding affinity for ERK2 In this assay, the reaction was initiated by the addition of 0.1 ␮M MKP3 in a mixture (0.2 ml) containing 20 mM pNPP, 1.2 ␮M ERK2, and various concentration of the KIM peptide or the MKP3 mutant. All peptides were obtained in high yield (Ͼ80%) and in high purity (Ͼ95%, as analyzed by matrix-assisted laser desorption ionization/time of flight mass spectrometry and analytical HPLC)

RESULTS AND DISCUSSION

Peptide n

Ionic strength