Abstract

In the present study, a new species of the genus Moniliformis species is described taxonomically in the mitochondrial genomic context. The parasite was found in a plateau zokor captured in a high-altitude area of Xiahe County of Gansu Province, China. The mitochondrial (mt) genome length of this new species was 14,066 bp comprising 36 genes and 2 additional non-coding regions (SNR and LNR), without atp8. The molecular phylogeny inferred by the cytochrome c oxidase subunit I gene (cox1) and the18S ribosomal RNA gene (18S rDNA) sequences showed that the parasite as a sister species to other Moniliformis spp. and was named Moniliformis sp. XH-2020. The phylogeny of the concatenated amino acid sequences of the 12 protein-coding genes (PCGs) showed Moniliformis sp. XH-2020 in the same cluster as Macracanthorhynchus hirudinaceus and Oncicola luehei confirming the cox1 and 18S rDNA phylogenetic inference. In addition, the entire mt genome sequenced in this study represents the first in the order Moniliformida, providing molecular material for further study of the phylogeny of the class Archiacanthocephala. Moreover, the species of this class, use arthropods as intermediate hosts and mammals as definitive hosts and are agents of acanthocephaliasis, a zoonosis in humans. Therefore, this study not only expands the host range among potential wild animal hosts for Archiacanthocephalans which is of great ecological and evolutionary significance but also has important significance for the research of zoonotic parasitic diseases.

Highlights

  • Acanthocephalans are obligate endoparasites of vertebrates that complete their life cycle with the participation of arthropods (Kennedy, 2006)

  • No complete mitochondrial genome sequence is available for this order, besides analysis of the taxonomic status of Moniliformis spp. and description of the mitochondrial genomic characteristic we provide the complete mt genome sequence while investigating the presence of Moniliformis spp. in plateau zokors captured in the high altitude areas of Gansu province

  • The complete mitochondrial genome obtained in this study provides molecular material for further molecular evolutionary analysis of Moniliformis spp

Read more

Summary

INTRODUCTION

Acanthocephalans are obligate endoparasites of vertebrates that complete their life cycle with the participation of arthropods (Kennedy, 2006). About 20 species exist in the order Moniliformida (Amin, 2013), its main definitive and intermediate hosts are rodents and insects respectively. Carnivores such as the families Canidae, Felidae and Mustelidae (Kozlov, 1977), as well as birds and hedgehogs. No complete mitochondrial (mt) genome sequence is available for this order, besides analysis of the taxonomic status of Moniliformis spp. and description of the mitochondrial genomic characteristic we provide the complete mt genome sequence while investigating the presence of Moniliformis spp. in plateau zokors captured in the high altitude areas of Gansu province. The complete mitochondrial genome obtained in this study provides molecular material for further molecular evolutionary analysis of Moniliformis spp

MATERIALS AND METHODS
F ATTGAGATCAGGAGTGACGGTGACC
RESULTS AND DISCUSSION
ETHICS STATEMENT
CONCLUSION
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.