Abstract
The MiR-126 is a highly conserved, non-coding RNA that is primarily expressed in human endothelial cells and is a crucial regulator of angiogenesis and vasculogenesis [1]. In human genomes, MiR-126 is found within intron 7 of the Epidermal Growth Factor-Like domain 7 (EGFL7) gene on chromosome 9 [2,3]. Processing of pre-MiR-126 i.e., the precursor miRNA, generates two mature strands: a) MiR-126-3p with the sequence: UCGUACCGUGAGUAAUAAUGCG and b) MiR-126-5p with the sequence: CAUUAUUACUUUUGGUACGCG [4,5].
Full Text 
Sign-in/Register to access full text options
Sign-in/Register to access full text options 
Published version (
Free)
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
