Abstract
Studies on the genome of endophytes reveal the metabolic potential of endophytic microbiome including both culturable and unculturable fractions. The metagenome analysis through the Illumina HiSeq platform gives access to the genetic data encrypted for the molecular machinery, which takes part in plant growth promotion activity of the endophyte in various aspects including production of plant growth hormones and enhancing nutrient availability for the host plant. The present work was undertaken to identify the genes involved in plant growth promotion activities from the endophytes of Emilia sonchifolia(Linn.) DC. through metagenome analysis. Metagenomic studies include the analysis of functional annotations which aid in the detection of biocatalysts taking part in the metabolic pathway of host plants. The annotations of expressed genes in different databases like NCBI Nr, KEGG, eggnog and CAZy resulted in enlisting the vast array of information on the genetic diversity of the endophytic microbiome. The metagenome analysis of endophytic bacteria from the medicinal plant E.sonchifolia unveiled characteristic functional genes involved in plant growth promotion such as nitrogen metabolism (nif) and siderophore production (enterobactin category), ipdC and tnaA (IAA producing), ACC deaminase coding genes (regulation of elevated ethylene levels in host tissues), Mo-Nitrogenase, nitrous-oxide reductase (nosZ), nitrate reductase (narG, napA), nitrite reductase (nirD) (nutrient assimilation and absorption) enterobactin siderophore synthetase components F and D and acid phosphatase genes. This clearly explains the effective plant-microbe relationship and the role of bacterial endophytic microbes in regulating the growth of host plants.
Highlights
Endophytes are non-pathogenic microbiome occupying internally in plant tissues and occupy in many plants
Many researchers screened the endophytic microbes associated with medicinal plants for analysing the active and passive role of these microorganisms in the synthesis of host-derived bioactive compounds [1, 2]
Amplification of the fragments was done by PCR for 8 cycles using P5 (5' AATGATACGGCGACCACCGAGATCTACAC 3') and P7 (5' CAAGCAGAAGACGGCATACGAGAT 3') primers
Summary
Endophytes are non-pathogenic microbiome occupying internally in plant tissues and occupy in many plants. In the present data analysis, the functional potential the database search and alignment to predict the gene of the endophytic microbiome was analysed using the functional annotations. The endophyticmetindicates the role of endophytes in the production of plant agenome data contains different genes like pstS, B, A, C, growth regulators.
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
