Abstract
BackgroundmicroRNA regulation plays an important role in the remodeling that occurs in response to pathologic and physiologic stimuli in skeletal muscle. In response to stress, microRNAs are dynamically regulated, resulting in a widespread “fine-tuning” of gene expression. An understanding of this dynamic regulation is critical to targeting future therapeutic strategies. Experiments elucidating this dynamic regulation have typically relied on in vitro reporter assays, ex vivo sample analysis, and transgenic mouse studies. Surprisingly, no experimental method to date allows rapid in vivo analysis of microRNA activity in mammals.MethodsTo improve microRNA studies we have developed a novel reporter assay for the measurement of skeletal muscle microRNA activity in vivo. To minimize muscle damage, hydrodynamic limb vein injection was used for the introduction of plasmid DNA encoding bioluminescent and fluorescent reporters, including click-beetle luciferase and the far-red fluorescent protein mKATE. We then applied this technique to the measurement of miR-206 activity in dystrophic mdx4cv animals.ResultsWe found that hydrodynamic limb vein injection is minimally damaging to myofibers, and as a result no induction of muscle-specific miR-206 (indicative of an injury response) was detected. Unlike intramuscular injection or electroporation, we found that hydrodynamic limb vein injection results in dispersed reporter expression across multiple hindlimb muscle groups. Additionally, by utilizing click-beetle luciferase from Pyrophorus plagiophthalamus as a reporter and the far-red fluorescent protein mKATE for normalization, we show as a proof of principle that we can detect elevated miR-206 activity in mdx4cv animals when compared to C57Bl/6 controls.ConclusionHydrodynamic limb vein injection of plasmid DNA followed by in vivo bioluminescent imaging is a novel assay for the detection of reporter activity in skeletal muscle in vivo. We believe that this method will allow for the rapid and precise detection of both transcriptional and post-transcriptional regulation of gene expression in response to skeletal muscle stress. Additionally, given the post-mitotic status of myofibers and stable expression of plasmid DNA, we believe this method will reduce biological variability in animal studies by allowing longitudinal studies of the same animal cohort.
Highlights
MicroRNA regulation plays an important role in the remodeling that occurs in response to pathologic and physiologic stimuli in skeletal muscle
MiRNAs are a type of short, non-coding RNA that post-transcriptionally regulate gene expression. miRNAs function by guiding the RNA-induced silencing complex (RISC) to target mRNAs, dictated by base pairing to target sites primarily in their 3′-untranslated regions (UTRs). miRNAs can downregulate the expression of several to hundreds of target genes by repressing translation and/or destabilizing target mRNAs [8,9]. miRNAs are required for normal skeletal muscle development in mice [10], and several miRNAs have been shown to be dynamically regulated during hypertrophy [11], acute exercise [12], regeneration after injury [13], and in the remodeling that occurs in response to genetic muscle disease [14,15,16,17]
Plasmid construction Two perfectly complementary miR-206 [NCBI:NR_029593] binding sites were inserted between the Xba1 and Fse1 restriction sites downstream of the CBG99 stop codon in pCBG99-Control (Promega, Madison, WI, USA) using the following oligonucleotide sequences: 5′-CTAGACC ACACACTTCCTTACATTCCAAAACCACACACTTCC TTACATTCCAGGCCGG, and 5′-CCTGGAATGTAAG GAAGTGTGTGGTTTTGGAATGTAAGGAAGT GTG TGGT. pcDNA-mKATE was a kind gift from Amy Palmer (University of Colorado at Boulder, Boulder, CO, USA), and pCMV-eGFP from Stephen Langer (University of-interest (ROI) analysis
Summary
MicroRNA regulation plays an important role in the remodeling that occurs in response to pathologic and physiologic stimuli in skeletal muscle. MicroRNAs are dynamically regulated, resulting in a widespread “fine-tuning” of gene expression An understanding of this dynamic regulation is critical to targeting future therapeutic strategies. MiR-206 has been shown to promote terminal differentiation of myoblasts by regulating the expression of genes including connexin43 [18], utrophin [19], pax3 [20], pax7 [21] and DNA polymerase α [22] Many of these studies rely on data obtained from transgenic mouse studies, and ex vivo sample analysis both currently invaluable to the study of miRNAs. The study of miRNA regulation in skeletal muscle, would benefit from a system that enabled rapid, reproducible, longitudinal in vivo reporter assays, at a fraction of the cost of transgenic mouse production and analysis, and with fewer animals needed than for ex vivo studies
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call