Abstract
The RNA polymerase core enzyme of Escherichia coli with the catalytic activity of RNA polymerization is assembled sequentially under the order: 2alpha --> alpha(2) --> alpha(2)beta --> alpha(2)betabeta'. The core enzyme gains the activities of promoter recognition and transcription initiation after binding the sigma subunit. The subunit-subunit contact surfaces of beta' subunit (1407 residues) were analyzed by testing complex formation between various beta' fragments and either the alpha(2)beta complex or the sigma(70) subunit. Results indicate that two regions, one central region between residues 515 and 842 and the other COOH-terminal proximal region downstream from residue 1141, are involved in binding the alpha(2)beta complex; and the NH(2)-terminal proximal region between residues 201 and 345 plays a major role in binding the sigma(70) subunit. However, both alpha(2)beta binding sites have weak activity of the sigma(70) subunit; likewise, the sigma(70) subunit-contact surface has weak binding activity of the alpha(2)beta complex. The sites involved in the catalytic function of RNA polymerization are all located within two spacer regions sandwiched between these three subunit-subunit contact surfaces.
Highlights
The RNA polymerase holoenzyme of Escherichia coli is composed of the core enzyme with the subunit composition of ␣2Ј and one of seven different species of the subunit
The core enzyme carries the catalytic activities for RNA polymerization, but the subunit is required for promoter recognition and transcription initiation from the promoters
The sites of tryptic cleavage were determined for all major cleavage products, and the COOH termini of these fragments were estimated from the fragment sizes estimated from the migration distance on SDS-polyacrylamide gel electrophoresis (PAGE) and the location of potential cleavage sites along Ј by trypsin
Summary
Construction of Expression Plasmids—Plasmid pGETC for expression of the intact Ј subunit was constructed in two steps. The resulting plasmid pGETC(ϩN) produced the Ј subunit with an additional peptide of MASSDGSKS sequence at the NH2 terminus because of the presence of ATG codon on the vector (as a part of the NdeI site) near the junction with the rpoC insert (note that the original initiation codon for the Ј subunit is GTG [24]). For construction of the expression plasmid pGEMDCH of the 70 subunit with a His tag at the COOH terminus, a PCR product was prepared using pGEMD [5] as template and a pair of primers, 5ЈGCAACCTGGTGGATCCGTCAG-3Ј and 5Ј- CCCGGAATTCAAGCTTTTAGTGGTGGTGGTGGTGGTGGTGATCGTCCAGGAAGC-3Ј, treated with BamHI and HindIII, and substituted for the corresponding segment of pGEMD.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
