Isolation and Characterization of 21 Microsatellite Loci in Cardiocrinum giganteum var. yunnanense (Liliaceae), an Important Economic Plant in China

Rong Li,Zhiling Dao,Junbo Yang,Jie Yang

doi:10.3390/ijms13021437

Abstract

Twenty-one microsatellite markers from the genome of Cardiocrinum giganteum var. yunnanense, an important economic plant in China, were developed with a fast isolation protocol by amplified fragment length polymorphism of sequences containing repeats (FIASCO). Polymorphism within each locus was assessed in 24 wild individuals from Gaoligong Mountains in western Yunnan Province, China. The number of alleles per locus ranged from 2 to 4 with a mean of 2.9. The expected and observed levels of heterozygosity ranged from 0.042 to 0.726 and from 0.000 to 1.000, with averages of 0.44 and 0.31, respectively. These polymorphic microsatellite markers should prove useful in population genetics studies and assessments of genetic variation to develop conservation and management strategies for this species.

Highlights

The herbaceous perennial genus Cardiocrinum (Endlicher) Lindley is a member of the lily family (Liliaceae) and contains three species and one variety, namely Cardiocrinum cathayanum
In the genus Cardiocrinum, except 13 microsatellite loci were developed from the genome of C. cordatum [8], no nuclear microsatellite primers or other types of markers have been reported for C. giganteum var. yunnanense
Polymorphisms of all 114 microsatellite loci were assessed in 24 wild individuals

Summary

Introduction

The herbaceous perennial genus Cardiocrinum (Endlicher) Lindley is a member of the lily family (Liliaceae) and contains three species and one variety, namely Cardiocrinum cathayanum With its attractive flowers (Figure 1), this species has attracted the attention of botanists and horticulturalists, who have taken an interest in the commercial development of this species as an ornamental resource [4]. It is an important economic plant in China. In the genus Cardiocrinum, except 13 microsatellite loci were developed from the genome of C. cordatum [8], no nuclear microsatellite primers or other types of markers have been reported for C. giganteum var. We have developed and characterized 21 microsatellite markers for Cardiocrinum giganteum var. Yunnanense, which will facilitate further investigations on the genetic diversity, population structure, and gene flow of this species We have developed and characterized 21 microsatellite markers for Cardiocrinum giganteum var. yunnanense, which will facilitate further investigations on the genetic diversity, population structure, and gene flow of this species

Results and Discussion

F: TGACACCCCCATACTTAGAC

Isolation of Microsatellite Loci

Detection of Polymorphism

Data Analysis

Conclusions