Interleukin-1β and Tumor Necrosis Factor-α Induce MUC5AC Overexpression through a Mechanism Involving ERK/p38 Mitogen-activated Protein Kinases-MSK1-CREB Activation in Human Airway Epithelial Cells

Joo-Heon Yoon,Kyoung Seob Song,Kwang Chul Chung,Ja Seok Koo,Won-Jae Lee,Eun Jin Yang,Jae Young Choi

doi:10.1074/jbc.m300096200

Abstract

Mucin hypersecretion is commonly observed in many inflammatory diseases of the respiratory tract. MUC5AC is generally recognized to be a major airway mucin because MUC5AC is highly expressed in the goblet cells of human airway epithelium. Moreover, it is regulated by various inflammatory cytokines. However, the mechanisms by which the interleukin (IL)-1beta and tumor necrosis factor (TNF)-alpha induce MUC5AC gene expression in normal nasal epithelial cells, and the signal molecules involved, especially in the downstream signaling of mitogen-activated protein (MAP) kinases, remain unclear. Here we show that pharmacologic or genetic inhibition of either ERK or p38 MAP kinase pathway abolished IL-1beta- and TNF-alpha-induced MUC5AC gene expression in normal human nasal epithelial cells. Our results also indicate that the activation of mitogen- and stress-activated protein kinase 1 (MSK1) and cAMP-response element-binding protein and cAMP-response element signaling cascades via ERK and p38 MAP kinases are crucial aspects of the intracellular mechanisms that mediate MUC5AC gene expression. Taken together, these studies give additional insights into the molecular mechanism of IL-1beta- and TNF-alpha-induced MUC5AC gene expression and enhance our understanding on mucin hypersecretion during inflammation.

Highlights

Mucin hypersecretion is commonly observed in many inflammatory diseases of the respiratory tract
The results showed that MUC5AC mRNA was significantly increased after treatment with IL-1␤ or tumor necrosis factor (TNF)-␣ in normal human nasal epithelial (NHNE) cells (Fig. 1A)
In order to investigate the possible involvement of ERK and p38 mitogen-activated protein (MAP) kinases in IL-1␤- and TNF-␣-induced MUC5AC gene expression, 20 ␮M PD98059, specific MEK1/2 inhibitor, or 20 ␮M SB203580, p38 inhibitor, were applied before treatment with IL-1␤ and TNF-␣

Summary

EXPERIMENTAL PROCEDURES

Materials—PD98059, SB203580, and anti-␣-tubulin antibody were purchased from Calbiochem. The oligonucleotide primers for ␤2-microglobulin (used as a control gene for the RT-PCR) were designed based on the GenBankTM human sequence (GenBankTM accession number XM007650, 5Ј primer CTCGCGCTACTCTCTCTTTCTGG; 3Ј primer GCTTACATGTCTCGATCCCACTTAA). Real time RT-PCR was performed on a PerkinElmer Life Sciences ABI PRISM௡ 7700 Sequence Detection System. The pellet was washed twice with lysis and kinase buffer and resuspended in kinase buffer containing 200 ␮M ATP and 2 ␮g of activating transcription factor 2 (ATF2) fusion protein It was incubated for 30 min at 30 °C and immunoblotted with phospho-ATF2 antibody. Preparation of Inducible Dominant-negative Mutant Stable Cell Lines—Plasmid encoding the kinase-deficient MEK1 mutant (pcDNA5-MEK1DN) was cut with BamHI and ligated with pBluescript (Stratagene, La Jolla, CA) This clone was cut with HindIII, filled in with Klenow, cut with SacII (Promega), and ligated with pTRE vector.

CGC GAG CTC CTCCCTCCC AGG CAG CCA

RESULTS

DISCUSSION