Interaction between PPAR γ and SORL1 gene with Late-Onset Alzheimer's disease in Chinese Han Population.

Hui Zhang,Bin Gong,Mingyao Du,Shanshan Wang,Xuelian Ma,Hongying Bai,Chunyang Xu,Wei Zheng,Linlin Hua,Xiaodong Li,Yutong Wang,Yunliang Wang,Jinfeng Li

doi:10.18632/oncotarget.15691

Abstract

AimsTo investigate the impact of sortilin-related receptor 1 gene 1 (SORL1) and peroxisome proliferator activated receptor gamma (PPAR G) gene single nucleotide polymorphisms (SNPs), gene- gene and gene- environment interactions and haplotype on late-onset Alzheimer’s disease (LOAD) risk.MethodsHardy-Weinberg equilibrium (HWE), haplotype analysis and pairwise linkage disequilibrium (LD) analysis were investigated by using SNPStats (available online at http://bioinfo.iconcologia.net/SNPstats). Logistic regression was performed to investigate association between SNPs and LOAD. Generalized multifactor dimensionality reduction (GMDR) was used to investigate the interaction among gene- gene and gene- environment interaction.ResultsLogistic regression analysis showed that LOAD risk was significantly higher in carriers of the A allele of rs1784933 polymorphism than those with GG (GA+ AA versus GG), adjusted OR (95%CI) = 1.63(1.27-1.98), and higher in carriers of G allele of the rs1805192 polymorphism than those with CC (CG+ GG versus CC), adjusted OR (95%CI) = 1.70 (1.25-2.27). GMDR analysis suggested a significant two-locus model (p = 0.0010) involving rs1784933 and rs1805192, and a significant two-locus model (p = 0.0100) involving rs1784933 and alcohol drinking. Haplotype containing the rs1784933- A and rs689021- C alleles were associated with a statistically increased LOAD risk (OR = 1.86, 95%CI = 1.37– 2.52, p < 0.001).ConclusionsWe conclude that rs1784933 and rs1805192 minor alleles, gene- gene interaction between rs1784933 and rs1805192, gene- environment interaction between rs1784933 and alcohol drinking, and haplotype containing the rs1784933- A and rs689021- C alleles are all associated with increased LOAD risk.

Highlights

Alzheimer’s disease (AD) was the main cause for dementia in persons with middle and old age [1], and is a complex and progressive neurodegeneration characterised by large numbers of senile plaques and neurofibrillary tangles in the brain [2]
We aimed to investigate the impact of peroxisome proliferator activated receptor gamma (PPAR G) and sortilin-related receptor 1 gene 1 (SORL1) gene single nucleotide polymorphisms (SNPs), additional gene- gene, geneenvironment interaction and haplotype combination on late-onset AD (LOAD) risk
We the others SNP within SORL1 and PPAR G gene were not associated with LOAD susceptibility after covariates adjustment

Summary

Introduction

Alzheimer’s disease (AD) was the main cause for dementia in persons with middle and old age [1], and is a complex and progressive neurodegeneration characterised by large numbers of senile plaques and neurofibrillary tangles in the brain [2]. Late-onset AD (LOAD) is more common type of AD and the heritability for susceptibility to LOAD could be 80% in previous studies [3]. The etiology and pathogenesis of LOAD are still not clear, AD was a multifactorial disease and the complex pathology was resulted by the interaction of both genetics www.impactjournals.com/oncotarget SNP ID Chromosome. Major/ minor alleles Nucleotide sequences/ Probe sequence SORL1. Rs689021 11:121500411 Intron variant rs3824966 11:121577474 Intron variant T/C. Forward: ACGTTGGATGCCAAGCTAATTCTCAGAGCC Reverse: ACGTTGGATGTTGACAGCACTCATCCGTTC rs1784933 11:121618707 Intron variant

Methods

Results

Conclusion