Abstract
The syndrome of inappropriate antidiuretic hormone secretion is characterized by excessive water uptake and hyponatremia. The extent of hyponatremia, however, is less than anticipated, which is ascribed to a defense mechanism, the vasopressin-escape, and is suggested to involve a tonicity-determined down-regulation of the water channel aquaporin-2 (AQP2). The underlying mechanism, however, is poorly understood. To study this, we used the mouse cortical collecting duct (mpkCCD) cell line. MpkCCD cells, transfected with an AQP2-promoter luciferase construct showed a reduced and increased AQP2 abundance and transcription following culture in hypotonic and hypertonic medium, respectively. This depended on tonicity rather than osmolality and occurred independently of the vasopressin analog dDAVP, cAMP levels, or protein kinase A activity. Although prostaglandins and nitric oxide reduced AQP2 abundance, inhibition of their synthesis did not influence tonicity-induced AQP2 transcription. Also, cells in which the cAMP or tonicity-responsive element (CRE/TonE) in the AQP2-promoter were mutated showed a similar response to hypotonicity. Instead, the tonicity-responsive elements were pin-pointed to nucleotides -283 to -252 and -157 to -126 bp. In conclusion, our data indicate that hypotonicity reduces AQP2 abundance and transcription, which occurs independently of vasopressin, cAMP, and the known TonE and CRE in the AQP2-promoter. Increased prostaglandin and nitric oxide, as found in vivo, may contribute to reduced AQP2 in vasopressin-escape, but do not mediate the effect of hypotonicity on AQP2 transcription. Our data suggest that two novel segments (-283 to -252 and -157 to -126 bp) in the AQP2-promoter mediate the hypotonicity-induced AQP2 down-regulation during vasopressin-escape.
Highlights
Medical Centre (2004.55) and a VICI grant of the Netherlands Organization for Scientific Research (NWO, 865.07.002)
As endogenous AQP2 abundance was increased in both pooled colonies treated with deamino-8-D-arginine vasopressin (dDAVP) (Fig. 1B), it was concluded that the dDAVP-induced luciferase activity in mpkCCD-AQP2-luc cells is due to AQP2 promoter-specific transcription
As tonicity-regulated AQP2 expression appeared to be arginine vasopressin (AVP)-independent (Fig. 4) while cAMP responsive element (CRE)-mediated transcription is changed with hypotonicity (Fig. 6A), we investigated which part of the AVP-cAMP-CREB-AQP2 promoter pathway was involved
Summary
Cgtcttccatggtggctttacc gactaaaaggcttgtgaggaaatgtgg cagaggaggctgtggccaaggaagg agcccccacaatgagtccagtgaccttc taccccatggagcccaccagcaccag gacgtctctgttttgcctcagggctgc ctcctcattaattcctcgttttttcctcag caccccatcttagcggactccagataag catccctgctcctgtttcacagctgac aaccctgtgctcccccccacccgaag cacgtggggtggcatggcggacttg cacttatagggccaggaggcgttcctg ggactccagataaggattgaccactctgttttcctcg ctggctggcctgggacaaatttaaaaggcaaaaggtcttgg. Nicity in cultured cells and in the kidney medulla [11, 12] and TonEBP knockdown or inhibition, and mutation of its tonicity-responsive element (TonE) in the AQP2 promoter, reduced AQP2 expression in mpkCCD cells [13, 14]. The role of TonEBP and its TonE element in AQP2 expression regulation is still controversial. The effects of hypotonicity on AQP2 expression and the underlying mechanisms have not been studied in great detail. It is unclear whether the regulatory changes during hypotonicity mirror the regulation under hypertonic conditions and involve changes in TonEBP or in the classical AVPcAMP signaling cascade elements. We tested and used the mpkCCD cell line, which shows dDAVP-induced expression of endogenous AQP2 [17]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
