Abstract
A cDNA clone for a novel carbonic anhydrase (CA) isozyme was isolated from human pancreas and salivary glands. The cDNA sequence of 1182 base pairs encoded a 317-amino acid protein with a predicted mass of 36.4 kDa. The highest similarity of this cDNA and the deduced amino acid sequence is to human CA V (mitochondrial CA), hereafter referred to as CA VA. Recombinant protein expressed in COS-7 cells transfected with this cDNA clone was enriched in a mitochondrial fraction. Confocal fluorescence microscopy showed cytoplasmic granular signals in COS-7 cells expressing a fusion protein of the novel CA and green fluorescent protein. Several lines of evidence suggest that the cDNA clone presented herein encodes a novel human mitochondrial CA isozyme, designated CA VB. CA VB has a hydrophobic N-terminal mitochondrial signal sequence (33 amino acid residues). Western blot analysis showed a 36-kDa protein precursor and a 32-kDa mature protein for CA VB. Similar to CA VA, CA VB is a "low activity" enzyme with a sensitivity to acetazolamide. The CA VB gene is located on Xp22.1. Northern blot analysis in normal human tissues demonstrated expression of a 1.3-kilobase transcript in heart and skeletal muscle, and reverse transcription-polymerase chain reaction analysis showed expression of CA VB in pancreas, kidney, salivary glands, and spinal cord but not in liver. CA VA mRNA expression was observed only in liver. These findings indicate these are two genetically distinct isoforms of human CA V, designated CA VA and CA VB, which have different patterns of tissue-specific distribution, suggest different physiological roles for the two mitochondrial isozymes.
Highlights
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AB021660
Analyses for Subcellular Localization and N-Glycosylation by Western Blot—Homogenates of COS-7 cells transfected with the pSI vector containing the full-length cDNA of carbonic anhydrase (CA) VB or the vector alone were separated into three fractions by ultracentrifugation according to a standard method that was described previously [15]
There were high similarities in cDNA and deduced amino acid sequences to other CA isozymes, indicating that the novel cDNA clone is a member of the CA gene family
Summary
RT-PCR and Subcloning for Homology Probing—A comparison of amino acid sequences of previously reported human CA isozymes and CA-related proteins (CA I to VIII) revealed several relatively well conserved amino acid sequences. GST-CA VB fusion protein was prepared by PCR amplification of the full-length coding cDNA fragment of CA VB using the primer pair U3 and L4, TTGTCGACGGGGTTGCTTGGCTGGTGGC (nt 1068 – 1087, SalI site is underlined) and cloned into a EcoRI/SalI site of pGEX-4T-2 vector (Amersham Pharmacia Biotech). Analyses for Subcellular Localization and N-Glycosylation by Western Blot—Homogenates of COS-7 cells transfected with the pSI vector containing the full-length cDNA of CA VB or the vector alone were separated into three fractions (cytoplasm, mitochondria, and nucleusenriched) by ultracentrifugation according to a standard method that was described previously [15]. The PCR-amplified products were cloned in-frame into a EcoRI/SalI site in front of a GFP cDNA in the eukaryotic expression vector pEGFP-N1 (CLONTECH) to make a CA VB-GFP fusion protein. The full field was scanned in square image formats of 1024 ϫ 1024 pixels
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call