Abstract
Triplet repeat tracts occur throughout the human genome. Expansions of a (GAA)(n)/(TTC)(n) repeat tract during its transmission from parent to child are tightly associated with the occurrence of Friedreich's ataxia. Evidence supports DNA slippage during DNA replication as the cause of the expansions. DNA slippage results in single-stranded expansion intermediates. Evidence has accumulated that predicts that hairpin structures protect from DNA repair the expansion intermediates of all of the disease-associated repeats except for those of Friedreich's ataxia. How the latter repeat expansions avoid repair remains a mystery because (GAA)(n) and (TTC)(n) repeats are reported not to self-anneal. To characterize the Friedreich's ataxia intermediates, we generated massive expansions of (GAA)(n) and (TTC)(n) during DNA replication in vitro using human polymerase beta and the Klenow fragment of Escherichia coli polymerase I. Electron microscopy, endonuclease cleavage, and DNA sequencing of the expansion products demonstrate, for the first time, the occurrence of large and growing (GAA)(n) and (TTC)(n) hairpins during DNA synthesis. The results provide unifying evidence that predicts that hairpin formation during DNA synthesis mediates all of the disease-associated, triplet repeat expansions.
Highlights
Tracts of pure repeating triplets, referred to either as trinucleotide- or triplet repeat (TR)1 tracts, occur throughout the human genome [1]
Lagging strand replication is predicted to lead to contractions by replication across hairpins formed in the template strand and expansion by DNA slippage to give hairpin formation in the Okazaki fragment [4, 5]
Secondary structures formed from the self-annealing of synthetic single-stranded genome. Expansions of a (GAA) and TTC TRs are much less stable [21,22,23] than the structures adopted by single-stranded CAG, CTG, GCC, and GGC TRs (9 –12); GAA and TTC do not self-anneal under physiological conditions of temperature and salt [21,22,23], (GAA)15 may self-anneal at low temperature [23]
Summary
GAA and TTC Expansion Reactions—Pol  replication reactions contained, in a final volume of 40 l, a 0.28 mM concentration of either all four dNTPs or just the two dNTPs required for replication of the template repeat tract (as indicated), 0.015 mCi of 32P-labeled dCTP or dATP, 5 M annealed primer-template, and 0.025 units/l of h-pol  (purchased from CHIMERx or purified to Ͼ95% purity as described elsewhere [44] and shown to have similar replication kinetics and expansion behavior to h-pol  generously provided by Sam Wilson) and replication buffer (final concentrations: 50 mM Tris-HCl (pH 8.0); 10 mM MgCl2, 2.5% glycerol, 20 mM NaCl, and 2 mM dithiothreitol). Endonuclease Digestion—Expansion products used for P1 digestion were generated in reactions prepared to contain 0.03 M triplet repeat primer and template and 0.03 M h-pol  in a final volume of 20 l. Control dsDNA was the product of a fill-in reaction using h-pol , a “random” sequence DNA template (5Ј-ACTGTGTCTGTCAGGCTATCGATAGACAGTACTGCATACAGAGCGACCTGATCC), a primer (5Ј-GGATCAGGTCGC), and radiolabeled dNTPs, under replication conditions described above. For P1 nuclease digestion, 0.3 pmol (total DNA) of h-pol  expansion products, control dsDNA, and control ssDNA were each added to P1 buffer containing 200 mM NaCl, 50 mM sodium acetate (pH 7.4), 1 mM ZnSO4, 5% glycerol, and 0.0016 units of P1 nuclease (Sigma) in a final volume of 30 l. For MboII digestion of synthetic oligonucleotides, 99- and 51-mer GAA and TTC repeat tracts were synthesized by the LCCC DNA synthesis facility, gel-purified, and end-labeled with T4 polynucleotide kinase (New England Biolabs). End-labeled oligonucleotides were incubated in replication buffer overnight, and 0.5 pmol was digested with a total of 7.5 units of MboII (2.5 units every 1 h were added to give a final reaction volume of 31 l) in digestion buffer at 37 °C for 3 h
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
