Abstract
As a highly potent and highly selective oral inhibitor of FLT3/AXL, gilteritinib showed activity against FLT3D835 and FLT3‐ITD mutations in pre‐clinical testing, although its role on colorectal cancer (CRC) cells is not yet fully elucidated. We examined the activity of gilteritinib in suppressing growth of CRC and its enhancing effect on other drugs used in chemotherapy. In this study, we observed that, regardless of p53 status, treatment using gilteritinib induces PUMA in CRC cells via the NF‐κB pathway after inhibition of AKT and activation of glycogen synthase kinase 3β (GSK‐3β). PUMA was observed to be vital for apoptosis in CRC cells through treatment of gilteritinib. Moreover, enhancing induction of PUMA through different pathways could mediate chemosensitization by using gilteritinib. Furthermore, PUMA deficiency revoked the antitumour role of gilteritinib in vivo. Thus, our results indicate that PUMA mediates the antitumour activity of gilteritinib in CRC cells. These observations are critical for the therapeutic role of gilteritinib in CRC.
Highlights
In the United States, nearly one-third of mortality due to cancer are caused by colorectal cancer (CRC).[1]
We aimed to examine the inherent mechanisms of apoptosis induced by gilteritinib and the role of associated pathways in response to gilteritinib therapy in CRC cells
Our results indicate that gilteritinib induces PUMA up-regulation in CRC cells via a p53-independent manner
Summary
In the United States, nearly one-third of mortality due to cancer are caused by colorectal cancer (CRC).[1]. FMS-like tyrosine kinase 3 (FLT3) is associated with the receptor of platelet-derived growth factor and c-Kit, having a key role in regulating early haematopoietic cells.[9,10] FLT3 belongs to the type III family of receptor tyrosine kinases.[11] The gene coding for FLT3 is present on chromosome 13.q12.12 It is expressed in dendritic cells and human haematopoietic progenitors and has important function in division, differentiation and survival of the leukaemic cells.[12,13,14] In patients with acute myeloid leukaemia (AML), FLT3 is frequently mutated and is associated with poor prognosis and reduced survival of patients.[15,16] One of frequently observed mutations is internal tandem duplications (ITD) of the juxtamembrane. The PUMA knockout cells were generated by selecting two gRNA sequences (GCTCCCCGGAGCCCGTAGAG and GTAGAGGGCC TGGCCCGCGA) that target PUMA and the synthesis of complementary, single-stranded oligos having BsmBI overhangs were done.
Sign-in/Register to view highlights & summary 
Published Version (
Free)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call